Table 2

Oligonucleotide primers and sequences

Visual opsin genea, reference geneb,

or plasmidc

Primer Name

Primer Sequence (5'→3')

Amplicon size (bp) and GenBank

accession number

Primers designed against GenBank accession

number or reference


LWS A180a

A180SpecExon2

GGGTTTACAACGTCTCCACTC

(1017)

[8]

A1803'UTR-DS

CAATGCAACTATGTTCATT

HQ260679

DQ168659

LWS P180a

pExon2

GATGGGTTTACGATGTCGCAACGG

(1020)

[8]

LWS2 IntRev

CAGTCCCGGCAGTAATAACAAAC

HQ260680

LWS S180a

a/sExon2

GATGGGTTTACAACGTCTCCACAC

1032

[8]

LWS1 IntRev

CATTTGCCATAAAGTTTCCGTTTATC

HQ260681

LWS S180ra

S180rEx1-Ex2span-S

GCAATCATACAAGAGATCC

(1082)

[35]

S180r3'UTR-S

ACACAAAACCTTCACTTTTAAGC

HQ260682

RH1a

RH1-F

ATGCATGGCTACTTTGTCC

(538)

DQ912024

RH1-S-R

GTGTGAAGATGTACCAGGCCACAC

HQ260686

RH2-1a

RH21-F

CATGGTGGACCCAATGATCTA

(827)

DQ234859

RH21-R

AGATAACAGGATTGTAAAGG

HQ391990

RH2-2a

RH22-F

CAGATCCATGGCAATTCAAA

(738)

DQ234858

RH22-R

TAAAGAAAATCCACGCAGCA

HQ260683

SWS1a

SWS1-F

TGCAGGCGCTCTTCATGG

(799)

DQ234861

SWS1-R

ATGAGCGGGTTGTAGAC

HQ260685

SWS2Ba

SWS2B-F

AGGGAGCCTGGGGCTTTTT

(803)

DQ234860

SWS2B-R

TGGAGGCTTTTGAGACACAG

HQ391991

SWS2Aa

SWS2A-F

GGCACTTCCATCAACACC

(480)

FJ711159

SWS2A-R

GAAGCAGAAAAGGAACATGACG

HQ260684

COIb*

Cyt-c-F

GAGCCCTTAAATGGGAGACC

(445)

ES373762

Cyt-c-R

GCTGCGAAAGCTTCTCAAAT

HQ391989

β-actin b

β-actin-F

GAAACCGGTTCCCTTAAAGC

(439)

EU143772.1

β-actin-R

GGGGTGTTGAAGGTCTCAAA

HQ260687+

Myosin-HC b

Myosin-HC-F

ACACCAGCCTTCTGAACACC

(491)

ES371087

Myosin-HC-R

CTCGGCCTGTCTCTTGTAGG

HQ260688

pGEM-T c

SP6

TATTTAGGTGACACTATAG

MCS (141) + Insert

Promega®

pGEM-T c

T7

TAATACGACTCACTATAGGG


*cytochrome c oxidase subunit 1.

Laver and Taylor BMC Evolutionary Biology 2011 11:81   doi:10.1186/1471-2148-11-81

Open Data