Table 1

Exon-intron junctions of the Aeadsx gene

Aeadsx gene

Exon No.

Exon size(bp)

Splice-donor

Intron size(bp)

Splice-acceptor

N° of Y


1?

---

---

---

---

2

518

A G

274879

N H

12

TTGCAG/gtaggtgtgaggcata

    tctcctctcttttcag/GCAACC

3a

45

P V

43797

G P

10

TACCAG/gtgagttcgctgttga

    tctcttctggtttcag/TTGGCC

3b

48

T D

85670

D E

9

GAACAG/gtgcgtacttccttaa

    tcgtttccaatttcag/ACGACG

4

135

E G

13860

Q A

11

ACGAAG/gtatgggggttcttac

    cttctctgcctcgcag/GTCAAG

5a

461

n.c.

208

Q M

5

gttgag/gtcattataagcttcc

acataatgaccacagt/GCAAAT

5b

465

n.c.

10392

Y D

8

cgacag/gtactgctattggagg

    tcaatccctcaaacag/GATACG

6

1063

n.c.

22437

n.c.

11

acgaag/gtgagtgttctttttt

    ctcttttcttcaacag/tttcac

7

449

n.c.

---

---

---

tacacacgtacacattaaaatag

Consensus

AG/gtRagt

YYYYYYYYYYYYNYag/G

8,02 +/- 2,15

C


The exon/intron/exon boundaries of Aeadsx gene are reported. Exonic coding sequences are shown in uppercase letters, and non-coding regions (n.c.) are in lowercase letters. Encoded aminoacids are reported above the first base of each triplet. R = A or G nucleotide. Y = T or C or nucleotide. N = any nucleotide. The number of pyrimidines (Y) in the 12 bp preceding the 3' splice-acceptor site (NYag) is indicated. The consensus number of pyrimidines (8.02) was derived from the analysis of 4688 Ae. aegypti splice-acceptor sites. The Aeadsx gene intron 5 (13,860 bp) represents the intron preceding the female-specific exon 5a, and its polypyrimidine stretch does not deviate significantly from the consensus. The splice-acceptor site of the short 208-bp intron preceding the female-specific exon 5b is a weak acceptor site, as is the female-specific exon 5b splice-donor site, which deviates significantly from the consensus sequence.

Salvemini et al. BMC Evolutionary Biology 2011 11:41   doi:10.1186/1471-2148-11-41

Open Data