Table 4

Primers for mtDNA and endosymbionts genes

Gene

Target species

Primers

Sequence (5'-3')

Reference


COI

Heliconius

Jerry

CAACATTATTTTGATTTTTTGG

Beltran et al. 2002

Pat

TTCAATGCACTAATCTGCCATATTA

tRNA-leu

Heliconius

George

TAGGATTAGCTGGAATACC

Beltran et al. 2002

and COII

Imelda

CATTAGAAGTAATTGCTAATTTAACTA

Wsp

Wolbachia

H81F

AACTAGCTACTACGTTCGTTTGC

This study

H681R

GCTACTCCAGCTTCTGCAC

A-clade

H308R

TTAAAGATGTAACATTTGACC

B-clade

wsp522R

ACCAGTTTTTGCTTGATA

Zhou et al. 1998

16S

Ricketsia

RSSUF

CGGCTTTCAAAACTACTAATCTA

von der Schulenburg

RSSUR

GAAAGCATCTCTGCGATCCG

et al. 2001

16S

Spiroplasma

27f

GAGAGTTTGATCCTGGCTCAG

Hurst et al. 1999

MGSO

TGCACCATCTGTCACTCTGTTAACCTC

Van kuppeveld et al.1992


Muñoz et al. BMC Evolutionary Biology 2011 11:358   doi:10.1186/1471-2148-11-358

Open Data