Table 2

Primers used in this study

Name

Sequence 5'-3'

Annealing Temperature (ºC)

Source


COI

COIF (F)

CCNGGDTTTGGDATDRTWTCWCA

45

Lázaro et al., 2009

COIR (R)

CCWGTYARMCCHCCWAYAGTAAA

45

Lázaro et al., 2009

Bar2 (F)

CGTTTAGAGYTNTCTGTTCCAGG

40

Lázaro et al., 2009

COIbarc_plat_R (R)

TAATTAAAATATAAACCTCAGGATG

40

Lázaro et al., 2009

BarT

ATGACDGCSCATGGTTTAATAATGAT

43

Álvarez-Presas et al., 2011

CYB

B3 (F)

TKRTWNTTCAGDTTKTTTCTGG

44

This study

B2 (R)

AAAATAYCACTCNGGCTTWAT

44

This study

N13

MS13Fi

GGTAGTTGCATAAATTAAAA

50

This study

N13R2

GCTGAGAAACGGAAGCAAATCGAAGGG

50

This study


F, forward; R, reverse.

Lázaro et al. BMC Evolutionary Biology 2011 11:274   doi:10.1186/1471-2148-11-274

Open Data