Table 1

PCR annealing temperatures, sequence length, and primer sequences

Locus

Annealing

temp.

Length/

# variable sites (bp)

PCR primer

Primer sequence (5'-3')


ND4

48°C

RFLP

ND4

CACCTATGACTACCAAAAGCTCATGTAGAAGC

LEU

ACCACGTTTAGGTTCATTTTCATTAC

CXCR4

55°C

116/4

CXCR4F2

TGGTCTGTGGATGCTGTCAT

CXCR4R

TGCAGTAGCAGATCAAGATGA

SLC8A3

58°C

342/6

SLC8A3F

CATTCGGGTCTGGAATGAAA

SLC8A3R

ACACCACCATCCCCTCTGTA

RAG1

56°C

359/7

Amp F1

ACAGGATATGATGARAAGCTTGT

RAG1R

TTRGATGTGTAGAGCCAGTGGTGYTT


Devitt et al. BMC Evolutionary Biology 2011 11:245   doi:10.1186/1471-2148-11-245

Open Data