Table 3

Oligonucleotide primer used to amplify and to sequence partial ERV genes.

Primer name

Primer sequences (5' → 3')

Expected size (bp)


gag

CTGTTGTTGAAGCGAAAG

1,080

TACCTTCAGCCGTGTTG


pol

ACCCGCTAACCAAAGA

1,578

TGTCTGACCCGATTACC


env-A

CCCGAACTCCCATAAACC

1,720

AAGGCCCAACTGTAAGTAACA*


env-B

CTGCGGCCTGACATAAC

1,060

AAGGCCCAACTGTAAGTAACA*


env-C

GAACCTGGTGGCCTGATCTAT

1,524

GGCCCAACTGTGAGTAACA


env-E

ACCTCTTTGCCTGACAATACA

1,320

TACAAGGCAGGGAACAAGTAG


pol-intF1

CAGACATACCGCTGACTG

n/a


pol-intR1

TGTACTGTCATCCGGGTTCTG

n/a


env-A-intF1

TGGTATGTCTTGGGGAAT

n/a


* The same reverse primer was used to amplify partial fragments of both env classes A and B. Forward primers were specific for each type of env gene.

1. Internal primers used only for sequencing.

n/a = not applicable

Nascimento et al. BMC Evolutionary Biology 2011 11:139   doi:10.1186/1471-2148-11-139

Open Data