Table 3

Primers used to amplify and sequence MHII╬▓ in H. abdominalis.

Name

Sequence 5'-3'

Location


MHIIb-E1F2

GCCTCCTTTTCCTCACCTTC

Exon 1

MHIIb-I1F

TTGCGACTACACATTCAGCA

Intron 1

MHIIb-I2F2

TTTTTTTATCCCTTAACACTTAGAATACAG

Intron 2

MHIIb-I2F3

CGGGTCAACGAGTTCTCAAC

Intron 2

MHIIb-I2R

ACCAATGATTGTTCGGGTGT

Intron 2

MHIIb-I2R2

TCGGGTGTGATAATGGTCTG

Intron 2

MHIIb-I2R4

GGCGGCTGATTATCATGTTT

Intron 2

MHIIb-I2R5

TTGCGCCAAGGACCGGTTTAATG

Intron 2

MHIIb-E3F

GACGGCGACTGGTACTATCA

Exon 3

MHIIb-E3R

TGATAGTACCAGTCGCCGTC

Exon 3

MHIIb-E3R2

TCTGCTTGGGGTAGAAGTCG

Exon 3

MHIIb-E4R

AAGGCTGGCGTGTTCCAC

Exon 4

MHIIb-I4F

CGGGGGTCTTAAATCCTGTT

Intron 4

MHIIb-E5F

CTTTCCCTGGGAGGCTTC

Exon 5

MHIIb-E6R

TGGGAACCAGAATGCGACC

Exon 6


Bahr and Wilson BMC Evolutionary Biology 2011 11:121   doi:10.1186/1471-2148-11-121

Open Data