Table 2

Primers for real-time qPCR, amplification efficiency (%) and amplicon size (bp).

Gene

Name

Sequence (5' to 3')

Efficiency

Size


α1

A1F

GACTTACTTCAGCCACTGGAAGAGCCT C

96

153

A1R

TTGAAGGCGTGCAGCTCGCTCAGAG

α2

A2F

GTCCTATTTCTCTCACTGGAAGGACGCG

85

153

A2R

ATGAACGCGTGCAGCTCGCTAAGGC

α3

A3F

CACATCATACCCTGGCACCAAGAC

95

172

A3R

CTGGTAGGCGTGGTAGGTTTGAAGAG

α4

A4F

TTCTCCCACTGGAAAGACCTCGG

70

138

A4R

ATGGAGCTCACTGAGCTCGAGAAG

β1 allele A

B1FA

TTATGGGAAACCCCAAGGTGGCCAA

91

131

B1R

GTGCAGTTTCTCGGAGTGCAGCACGC

β1 allele B

B1FB

TTGTGGGAAACCCCAAGGTGGCTGC

98

131

B1R

GTGCAGTTTCTCGGAGTGCAGCACGC

β2

B2F

CCTGTACAATGCAGAGACCATCATGGC

84

151

B2R

GTGCAGCTTGTCAGAGTGGAGCAGAG

β3

B3F

ACAGATAGTGAGCGCGCCATCATTAA

86

176

B34R

GCGGCGATCAGGGGGTTGCACAG

β4

B4F

ACAGATAGTGAGCGCGCCATCATTAC

95

176

B34R

GCGGCGATCAGGGGGTTGCACAG

β5

B5F

GTGGACTCGGAGGTACTTTGGAAAC

89

168

B5R

TGCAGCTGACTGAGCTCGCAATAG

Ubiquitin

UbiF

GGCCGCAAAGATGCAGAT

81

69

UbiR

CTGGGCTCGACCTCAAGAGT


Wetten et al. BMC Evolutionary Biology 2010 10:315   doi:10.1186/1471-2148-10-315

Open Data