Table 1

PCR primers for amplification of cod α1-β1 gene pair and for screening BAC library.

Gene

Name

Sequence (5' to 3')


α1-β1

A1-B1F

GCAAATTGTTCAAGTTATTCCCCCTAAC

A1-B1R

TAAAGACTGACCTGCAACGCGAGTGGT

α1

A1-bacF

CAGACCAAGACTTACTTCAGCC

A1-bacR

GCTCGCTCAGAGTGAGAAGAC

α2

A2-bacF

CCGATGATATCGGAGCTGAGG

A2-bacR

CTAAGGCTGAGGAGTCCTCC

β1

B1-bacF

ATGGTTGAATGGACAGCTGC

B1-bacR

GTCGACGTGCAGTTTCTC

β2

B2-bacF

TGGACAGATAGTGAGCGCG

B2-bacR

AGTGGAGCAGAGACAGCTC


Wetten et al. BMC Evolutionary Biology 2010 10:315   doi:10.1186/1471-2148-10-315

Open Data