Table 1

Primers used in the study. F, forward; R, reverse.

Gene

Name

Sense

Sequence

Reference


cox1

Jerry (M202)

F

CAACATTTATTTTGATTTTTTGG

[72]

Pat (M70)

R

TCCA(A)TGCACTAATCTGCCATATTA

[72]

Chy

F

T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT

A. Cieslak, this work

Tom

R

AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A

A. Cieslak, this work

Tom-2

R

A(A/G)GGGAATCATTGAATAAA(A/T)CC

A. Cieslak, this work

cob

CB3

F

GAGGAGCAACTGTAATTACTAA

[73]

CB4

R

AAAAGAAA(AG)TATCATTCAGGTTGAAT

[73]

rrnL-nad1

16saR (M14)

F

CGCCTGTTTA(A/T)CAAAAACAT

[72]

16Sa

R

ATGTTTTTGTTAAACAGGCG

[72]

16Sb

R

CCGGTCTGAACTCAGATCATGT

[72]

16SAlf1

R

GCATCACAAAAAGGCTGAGG

[74]

ND1A (M223)

R

GGTCCCTTACGAATTTGAATATATCCT

[72]

16Sbi

F

ACATGATCTGAGTTCAAACCGG

[72]

FawND1

R

TAGAATTAGAAGATCAACCAGC

[72]

SSU

5'

F

GACAACCTGGTTGATCCTGCCAGT

[32]

b5.0

R

TAACCGCAACAACTTTAAT

[32]

LSU

Ka

F

ACACGGACCAAGGAGTCTAGCATG

NHM (2000)

Kb

R

CGTCCTGCTGTCTTAAGTTAC

NHM (2000)


Ribera et al. BMC Evolutionary Biology 2010 10:29   doi:10.1186/1471-2148-10-29

Open Data