Table 1

PCR primer sequences
cMyc forward 5’-CAGCGACTCTGAAGAAGAGC-3’
reverse 5’-GTTGTGCTGGTGAGTGGAGA-3’
Wnt-4 forward 5’-ATGCCCTTGTCACTGCAAA-3’
reverse 5’-CTGGACTCCCTCCCTGTCTT-3’
TGF-β2 forward 5’-AAGCTTCGGGATTTATGGTG-3’
reverse 5’-TGGAGTTCAGACACTCAAA-3’
RANKL forward 5’-TGAAGACACACTACCTGACTCCTG-3’
reverse 5’-CCACAATGTGTTGCAGTTCC-3’
Rspo1 forward 5’- CGACATGAACAAATGCATCA -3’
reverse 5’- CTCCTGACACTTGGTGCAGA -3’
Rspo2 forward 5’- GCCCATCAGGGTATTATGGA -3’
reverse 5’- TCACAGTTTTCTATTCTGCATCG -3’
β-Actin forward 5’- CTAAGGCCAACCGTGAAAAG -3’
reverse 5’- ACCAGAGGCATACAGGGACA -3’

Gauger et al.

Gauger et al. BMC Developmental Biology 2012 12:25   doi:10.1186/1471-213X-12-25

Open Data