Table 2

Primer sequences

Primer name

Sequence


human RT-PCR

TTAGTGCATGGTCAGGTGAGG

mouse RT-PCR

TCTCCCATCTTCACTCTCATCAG

chicken RT-PCR

GCTGTGTTCTGACTTCATCC

hten PCR1 rev

GTGTCCACATCAGATCCCATCTC

hten nested XbaI rev

TAGTTCTAGAGCACAGGTGCAGGCATGAGG

mouse PCR1 rev

CTCCAGCTGGTAGCCATGTCG

mouse nested XbaI rev

TAGTTCTAGATCTGTGTGGTAGCCGGAGCAC

chicken PCR1 rev

ATGCGCCACCTTCGGTTTCAG

chicken nested XbaI rev

TAGTTCTAGAGTAGCTGTGCTCCGACACACC

oligo dT anchor primer

GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTT

hten1 promotor 1 XhoI fw

ACTACTCGAGCAAGACCCATGCTGAAGCT

hten1 promotor 1 HindIII rev

ACTAAAGCTTCTCTGATTAAGCAAGCTCAGTTTC

hten1 promoter 2 NheI fw

ACTAGCTAGCCCCCTAGAGTGTTCAGCTCT

hten1 promoter 2 EcoRI rev

ACTAGAATTCGGGCCACCTCAAAAACACCTCC

mutate promoter 2 fw

CCACCCCTCACCCTCAGGAGAAAGTGGTTAAA

mutate promoter 2 rev

TTTAACCACTTTCTCCTGAGGGTGAGGGGTGG

total ten1 qPCR fw

GCATAGTTCCTGTTTGTCCA

total ten1 qPCR rev

TCTGCACATCTTGAGTAGAC

alt exon qPCR fw

GCTTGGAATAGGAATTACAAGG

alt exon qPCR rev

GAAGTCCTTTAATGCAAGCAG

hGAPDH qPCR fw

GGAGTCAACGGATTTGGTC

hGAPDH qPCR rev

AAACCATGTAGTTGAGGTC

ChIP target region fw

TTCAGCTTCCTCGTTCTTCG

ChIP target region rev

GGTGGTTACAACCGCCTTTT

ChIP negative control fw

AGATTCCTGTGAGCCCTGCT

ChIP negative control rev

TCCAACAACTCATGCAATGG


Beckmann et al. BMC Developmental Biology 2011 11:35   doi:10.1186/1471-213X-11-35

Open Data