Table 1

Sequences obtained in 5'RACE (Translation start site in bold and underlined)

clone name

sequence


h1_cl_1

TTTTTTTTTTTTTTTGAACTGAGCTTGCTTAATCAGAG

    ATG
GAGCAAACTGACTGCAAACCCTACCA

GCCTCTACCAAAAGTCAAGCATGAAATGGATCTAGCTTACACCAGTTCTTCTGATGAGAGTGAAG

ATGGAAGAAAACCAAGACAGTCATACAACTCCAGGGAGACCCTGCACGAGTATAACCAGGAGCT

GAGGATGAATTACAATAGCCAGAGTAGAAAGAGGAAAGAAGTAGAAAAATCTACTCAAGAGAT

GGAATTCTGTGAAACCTCTCACACTCTGTGCTCTGGCTACCAAACAGACATGCACAGCGTTTCTCG

GCATGGCTACCATCTAGA


h1_cl_2

TTTTTTTTTTTTTTTTGGCGGGGGANCAGCACCTGGGGACGCCGCCGAAACTTGCGCTTGGAATA

GGAATTACAAGGGTGACCTTTATTCCGCTGTCTCCTTTTTGATTCCCATAACTTCTGGACCTATCAA

GGACTGCTTGCATTAAAGGACTTCCTCATCCTTTTTTTCATGAAACTGAGCTTGCTTAATCAGAG

    A

    TG
GAGCAAACTGACTGCAAACCCTACCAGCCTCTACCAAAAGTCAAGCATGAAATGGATCTAGCT

TACACCAGTTCTTCTGATGAGAGTGAAGATGGAAGAAAACCAAGACAGTCATACAACTCCAGGG

AGACCCTGCACGAGTATAACCAGGAGCTGAGGATGAATTACAATAGCCAGAGTAGAAAGAGGA

AAGAAGTAGAAAAATCTACTCAAGAGATGGAATTCTGTGAAACCTCTCACACTCTGTGCTCTGGC

TACCAAACAGACATGCACAGCGTTTCTCGGCATGGCTACCATCTAGA


m1_cl_1

TTTTTTCCACCGCCACCTCCTCCACATGCCTGCACCTGTGCCAGGAAGCCACCTCCTACAGTGGAC

TCTCTACAAAGAAGATCAATGACTACCCGCAGCCAGCCCAGCCCAGCTGCTCCTGCTCCTCCAACC

AGCACACAGGATTCGGTTCATCTGCATAACAGCTGGGTCTTGAACAGTAACATACCGCTGGAGAC

CAGGTACATTTTATGATTGACCATTTCAGCAAAGACTGTTTTCATTAAAGAACTTCCTTATCCTTTT

TTCATGAAACTCAGCTTGCTTAATCAGAG

    ATG
GAGCAAACAGACTGCAAACCTTATCAGCCTCTG

TCCAAAGTCAAGCATGTCTAGA


m1_cl_2

TTTTTTCCCGCAGGAACCAGCAAAGACGCCCTAAGTCCAGCGCACTTACAGCACACCAGCAGAGC

TGAGTACCTGGCAAGGAGGCGGGGGACCGCACCTGAGGACATCACTGAAACTTGCGCCTGGACT

AGTCCTTCTACTGCCATGGAAACTAGATGGCACAGACAGCGGAGAGTCACTCATTCAGAACAGG

GGCCCCCTTTTTAATTTCATGTCAGCCTGTTGGTCCCTGAAAGTAACTGAAAAGGAATTACAAGA

GCGACTTTTATTCTGTGTAACTTCTCTTCTGGATCTAACAAGGTACATTTTATGATTGACCATTTCA

GCAAAGACTGTTTTCATTAAAGAACTTCCTTATCCTTTTTTCATGAAACTCAGCTTGCTTAATCAGA

G

    ATG
GAGCAAACAGACTGCAAACCTTATCAGCCTCTGTCCAAAGTCAAGCATGTCTAGA


c1_cl_1

TTTTTTTCCTCATTCCTTAAGGAATTCCAGTTGCTTGTTTTCATGATTTTGAGCCTATTCAGCCAGA

G

    ATG
GAGCAGATGGACTGCAAACCCTACCAGCCACTGTCAAAAGTTAAACATGAAGTGGATCTA

ACNTTACACAAGTTCTTCAGATGAAAGTGAAGATGGCAGAAAGCAAAGGCAATCTTATGACTCA

AGAGAAACTCTGAATGAATATAGCCAAGAGCTAAGACTGAACTACAACAGTCAAGGCAGAAAAA

GAAAAAATACTGACCAATCCACACAAGACATGGAATTCTGTGAGACACCCCACATTCTGTGCTCT

GGCTACCAAACAGATTTACATGGTGTGTCGGAGCACAGCTACCCACTAGAGGTGGGCTCAGATG

TTGATACTGAAACCGAAGGTGGCGCATCACCAGATCATGCCCTGAGGATGTGGATGAGGGGGAT

GAAGTCAGAACACAGCTCCTGTCCGTCAAGCCGGGCAAACTCAGCGTTGTCCCTGACTGACACTG

ACCATGAGAGGAAGTCTGATGGGGAGAATGACATGCCGGGGAGCCCACACAACCAGTTCACGTT

TCTAGA


c1_cl_2

TTTTTTTCGCCGAGCCTAGAGGCGATGGGAGCTGCCGAGCCGGGGCGCTGCTGAAAGTTCAGCC

GGTGGCCGCGCAGCGCGGACTCATCCTTAAGGAATTCCAGTTGCTTGTTTTCATGATTTTGAGCC

CATTCAGCCAGAG

    ATG
GAGCAGATGGACTGCAAACCCTACCAGCCACTGTCAAAAGTTAAACAT

GAAGTGGATCTAACTTACACAAGTTCTTCAGATGAAAGTGAAGATGGCAGAAAGCAAAGGCAAT

CTTATGACTCAAGAGAAACTCTGAATGAATATAGCCAAGAGCTAAGACTGAACTACAACAGTCAA

AGCAGAAAAAGAAAAAATACTGACCAATCCACACAAGACATGGAATTCTGTGAGACACCCCACA

TTCTGTGCTCTGGCTACCAAACAGATTTACATGGTGTGTCGGAGCACAGATACTCTAGA


Beckmann et al. BMC Developmental Biology 2011 11:35   doi:10.1186/1471-213X-11-35

Open Data