Table 1

Oligonucleotide sequences used for RT-PCR, RT-qPCR analyses and morpholino design

Primers for ΔNp53 PCR amplification (see Fig. 1A)


Gene

Forward

Reverse


E2/E11

GCAAAACGACAGCCAAGAGT

ACGTCCACCACCATTTGAAC


I2/E5

CAGCCATGTCAGGTTGCTAT

CACCTTAATCAGAGTCGCTTC



Primers for quantitative PCR (see Fig. 5)


Gene

Forward

Reverse


p21

GGAAAACATCCCGAAAACACC

TGTGATGTTGGTCTGTTTGCG


ΔNp53

CCTGATACACAACGCTCCTCT

TGATGTCCCAGCAAGAGCC


Δ113p53

ATTCTGTGTGACATTACAAGACCAGG

GTTTATTCAGGTCCGGTGAATACC


ELF1A1

CTTCTCAGGCTGACTGTGC

CCGCTAGCATTACCCTCC



Primers for semiquantitative PCR (see Figs. 1C/2A)


Gene

Forward

Reverse


Δ113p53

TTTGGAGGGAGATGTTGGTC

GTTATCTCCATCCGGGGTTC


ΔNp53

TGCATCTGTCGAACGTATTG

GTTATCTCCATCCGGGGTTC


β-Actin

GATGTGGATCAGCAAGCAGGAGTA

CGAGAGTTTAGGTTGGTCGTTCGT



Morpholino sequences


Gene

Sequence


p53

5'GCGCCATTGCTTTGCAAGAATTG3'


ΔNp53

5'AGGTACATTATAGCAACCTGACATG3'


p21

5'TAATAAAGAGGTCTGACCTGTGATG3'


standard control

5'CCTCTTACCTCAGTTACAATTTATA3'


ΔNp53 mismatch control

5'AGcTAgATTATAGgAACCTcACtTG3'


Davidson et al. BMC Developmental Biology 2010 10:102   doi:10.1186/1471-213X-10-102

Open Data