Table 1

Primer sequences

Primer

Primer sequences (listed 5' – 3')


GAPDH

Forward CATGTGGGCCATGAGGTCCACCAC

Reverse TGAAGGTCGGTGTGAACGGATTTGGC

c-Met

Forward ACCTGCTGAAATTGAACAGCGAGC

Reverse ACACTTCGGGCACTTACAAGCCTA

SOS2

Forward TAGAGAAAGGCGAGCAGCCAATCA

Reverse AGGGTGAGATTTGTGGTATGGCGA

CD44

Forward GCCTGGCGCAGATCGATTTGAATA

Reverse CCCTGTGTTGTTTGCTGCACAGAT

Tenascin-C

Forward AGATGTCACAGACACCACTGCCTT

Reverse TGTGGCTTGTTGGCTCTTTGGAAC

CD13

Forward TCCACACCTTTGCCTACCAGAACA

Reverse TGCCTGATGTGCTGAAGAGATCGT

CD26

Forward TGGAGGCATTCCTACACAGCTTCA

Reverse ACAGCTCCTGCCTTTGGATATGGA


Fleming et al. BMC Cell Biology 2008 9:46   doi:10.1186/1471-2121-9-46

Open Data