Table 1

Primer sequences and resulting product size of RT-PCR with genomic DNA and cDNA as template

Primer Sequences

genomic DNA [bp]

cDNA [bp]


c"1 (At4g32530)

F: AGAGAGAGAGAGAGAGAG

1578

561

R: CTATTTTGTAGGCCATGT

c"2 (At2g25610)

F: TCAAATTCATTCATATCA

943

570

R: CTATTTTGTAGGCCATGT

c1 (At4g34720)

F: ATTTCAGATTTAAGATCT

979

531

R: TCATTCGGCTCTGGACTGACC

c2 (At1g19910)

F: GTCTCATTCCCGATCAGA

1039

532

R: TCATTCGGCTCTGGACTGACC

c3 (At4g38920)

F: AGCACATATTTTAAGATC

1617

528

R: TCATTCGGCTCTGGACTGACC

c4 (At1g75630)

F: ATCTCATCGGAGCAACAG

1402

532

R: TCATTCGGCTCTGGACTGACC

c5 (At2g16510)

F: ATCCAAAACTTTGAGATC

829

519

R: TCATTCGGCTCTGGACTGACC


Seidel et al. BMC Cell Biology 2008 9:28   doi:10.1186/1471-2121-9-28

Open Data