Table 1

Gene names and its primers.

Gene name

Primers

Accession no.


mAdipoR1

CTTCTACTGCTCCCCACAGC

NM_028320

TCCCAGGAACACTCCTGCTC

mAdipoR2

CCACACAACACAAGAATCCG

XM_132831

CCCTTCTTCTTGGGAGAATGG

mCypB

TCGGAGCGCAATATGAAGGT

BC013061

TTCTTCTTATCGTTGGCCACG

mCol-I

AACCCGAGGTATGCTTGATCT

NM_007742

CCAGTTCTTCATTGCATTGC

mOCN

TGCTTGTGACGAGCTATCAG

L24431

GAGGACAGGGAGGATCAAGT

mRunx-2

AAGTGCGGTGCAAACTTTCT

NM_009820

TCTCGGTGGCTGGTAGTGA

mOsterix

CCCTTCTCAAGCACCAATGG

AF184902

AGGGTGGGTAGTCATTTGCATAG

m36B4

AAGCGCGTCCTGGCATTGTCT

NM_007475

CCGCAGGGGCAGCAGTGGT

HPRT

CAGTCCCAGCGTCGTGATTA

J00423

AGCAAGTCTTTCAGTCCTGTC


Primer pairs used for studying various genes.

m; mouse, AdipoR; adiponectin receptor, CypB; cyclophilin B, Col-I; collagen type I, OCN; osteocalcin, HPRT; hypoxanthine phosphoribosyltransferase.

36B4 and HPRT are housekeeping genes.

Kanazawa et al. BMC Cell Biology 2007 8:51   doi:10.1186/1471-2121-8-51

Open Data