Table 2

Primers and probes for TaqManR analysis

target

primers/probes

sequence (5'-3')


cyclophylline

5-HCYP

GTCTCCTTTGAGCTGTTTGC

3-HCYP

CCTTATAACCAAATCCTTTCTCTCCA

HCYP-FAM

TGCTCAGAGCACGAAAATTTTTTGCTGTC

Col1A1

5-COL1A1

ACAGCCGCTTCACCTACAGC

3-COL1A1

TCAATCACTGTCTTGCCCCA

COL1A1-FAM

ACTGTCGATGGCTGCACGGAGTCACAC

Col3A1

5-COL3

TCTTGGTCAGCTCTATGCGGA

3-COL3

TGTCATCGCAGAGAACGGATC

COL3-FAM

AGAGATGTCTGGAAGCCAGAACCATGCC

MMP 2

5-MMP2

CGCTCAGATCCGTGGTGAG

3-MMP2

CTTGTCACGTGGGCGTCACA

MMP2-FAM

CTTCAAGGACCGGTTCATTTGGCG


Jansen et al. BMC Cell Biology 2006 7:36   doi:10.1186/1471-2121-7-36

Open Data