Table 1

Primer used in qRT-PCR analysis
Gene Forward primer (5’-3’) Reverse primer (5’-3’)
MYOIC (isoform A) ggagagatcatccgtgtggt ggaccgatgtaggtataaatgagg
MYOIC (isoform B) gcgctaccgggcatcg ggaccgatgtaggtataaatgagg
GAPDH ggtgaaggtcggtgtgaacg ctcgctcctggaagatggtg

Sielski et al.

Sielski et al. BMC Cell Biology 2014 15:8   doi:10.1186/1471-2121-15-8

Open Data