Table 2

List of primer pairs selected for RT-qPCR confirmation of BORIS associated transcripts in (A) hNP1 an hNP1 cells differentiated to neurons over 6 days (6dN), (B) HEK293T cells over-expressing BORIS
A.
Gene Forward Primer Reverse Primer Exons
RNF160 AAGTTTTGGAAGTATGGAAAACACA GCTCACTTTGGATGCTTCCTCT 6-7
TTBK2 ATTGGCTGTGGGAGGAATGA GTCTACCCAGCCGGAGAGTG 4-5
SKI CTGGACGACGTGAAGGAGAAA GGGACTGGGAAGAGGTGTCAT 1-2
PCLO CACATGCACTGAGTGTCAAACC CCGCCTAGAGCTCTTTTCATTT 3-4
APC TGGAAGCAGAGAAAGTACTGGA GATTCTGAAGTTGAGCGTAATACCA 4-5
BCL2 CCTGTGGATGACTGAGTACCTGA TCTTCAGAGACAGCCAGGAGAA 1-2
HIP1 TGTAAAGGAAAAACACGCCAGA TGTGGAACACATGGCAGAACTT 2-3
SOX4 GTTCGGCGTGTGCTTGG GCAGCGCTTCCGTGTTCT
APLP2 GCTCCTGCTTCTGCTGCTG CCCATTTCCCAGTCTGAATGTT 1-2
CALR CTCCCGATCCCAGTATCTATGC TTGTTTCTCTGCTGCCTTTGTT 7-9
POU3F1 CAACAAGTGGCTGGAGGAGAC GGCACTTGAGAAAGTGGCTCTC
B.
Gene Forward Primer Reverse Primer Exons
CHD8 CATCGAGTGTTGGATAACTTCTCTG ATCCATCATCATCAAGGGATCA 26-28
CTBP2 GAGAGTGATCGTGCGGATAGG AGAGTCCGCTGTCTCTTCCAC 5-6
CTNNB1 TGAAAATCCAGCGTGGACAAT GGTAAGACTGTTGCTGCCAGTG 2-3
FZD5 CGCTTCTCAGCGGAGTGAC AGACGGTTAGGGCTCGGATT 1-2
LEF1 AATGAGAGCGAATGTCGTTGC TCATAATATTTAGCCTGCTCTTCACG 7-8
LRP6 TTTATTGGGCAGATGCAAAACTTA AATAACGTCAAGGCAAAAGGATGT 3-4
TLE1 TCCCCCTCACATGAGAGTACC GAAAAGGGACAGGCTGCATCT 13-14
TCF4 ACCTCTTCCTGTACGCCTCCT GATCTGGAGAATAGATCGAAGCAA 11-12
TCF3 TCTCGTCCAGCCCTTCTACC CGTCCAGGTGGTCTTCTATCTTAC 13-15
WNT5A CGACATCGAAGGTGGAACTG CGTTCACCACCCCTGCT 3-4
APC TGGAAGCAGAGAAAGTACTGGA GATTCTGAAGTTGAGCGTAATACCA 4-5
TBP CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC 5-6

Ogunkolade et al.

Ogunkolade et al. BMC Cell Biology 2013 14:52   doi:10.1186/1471-2121-14-52

Open Data