Table 1

The primers for quantitative real-time RT-PCR
Gene Forward Primer (5'-3') Reverse Primer (5'-3')
KGF AAAAGAGGCAAAGTAAAAGGGAC CCATTTAGCTGATGC ATATGTGTTG
Snail CAAGGATCTCCAGGCTCGAA GGCACTGGTACTTCTTGAC
EGFR GAGTAACAAGCTCACGCAGTTG GAGGACATAACCAGCCACCTC
GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT

Huang et al.

Huang et al. BMC Cell Biology 2013 14:13   doi:10.1186/1471-2121-14-13

Open Data