Table 1

Primer sequences, product size and annealing temperature
Gene Sequence Product size Annealing temp
sFRP1 Forward: ATCTCTGTGCCAGCGAGTTT 202bp 55°C
Reverse: AAGTGGTGGCTGAGGTTGTC
sFRP2 Forward: AGGACAACGACCTTTGCATC 217bp 55°C
Reverse: TTGCTCTTGGTCTCCAGGAT
sFRP3 Forward: AAACTGTAGAGGGGCAAGCA 227bp 55°C
Reverse: GGCAGCCAGAGCTGGTATAG
sFRP4 Forward: CGATCGGTGCAAGTGTAAAA 181bp 54°C
Reverse: GACTTGAGTTCGAGGGATGG
sFRP5 Forward: GATGTGCTCCAGTGACTTTG 352bp 60°C
Reverse: GCAGGGGTAGGAGAACATGA
GAPDH Forward: CAGAACATCATCCCTGCATCCACT 185bp 59°C
Reverse: GTTGCTGTTGAAGTCACAGGAGAC
L19 Forward: GGACAGAGTCTTGATGATCTC 194bp 51°C
Reverse: CTGAAGGTCAAAGGGAATGTG
β-actin Forward: GCACCAAGGATGGAGATGTT 173bp 55°C
Reverse: GGACAGAGTCTTGATGATCTC

Saran et al.

Saran et al. BMC Cell Biology 2012 13:25   doi:10.1186/1471-2121-13-25

Open Data