Table 3

Primers used in this study

Primer name

Sequence


IAA17-2HA-R

5'-AAAATGCATTGCTGCAGCTCGAGCTCTGCTCTTGCAC-3'

IAA17-2HA-F

5'-AAAATGCATGCTGCAGCTCGAGCATACCCATACGATGTACCTGATTATGC

TGGTTATCCTTATGATGTTCCAGACTATGCTATGATGGGCAGTGTCGAG-3'

mcm4C-F

5'-GGAATTCCATATGACTAGTGCAACTGATCCTGCAACAGGA-3'

mcm4C-R

5'-TTCCCCCGGGTTATCGTCGACTACCTGCAGGATCAGTATGTGCAATTGAA

CGTAC-3'

mcm4dw-F

5'-GGGGTACCGAATTCAGCGAATAAGCTGGTATTATTCATGAGC-3'

mcm4dw-R2

5'-GGAAGATCTGGATCCTCGAGCTACGAATCATGGCGAATTATTGGTTACG-3'

skp1-F

5'-CCATCGATCATATGGCTAGCCCTGCAGGGATGTCCAAAATCAAACTGATT

TCATCTGAC-3'

skp1-R

5'-GGAATTCACTAGTCAGATCTCCTGCGCCGGCTCCAGCACCAAGATCTGG

GATCCCTCTGTCTTCGGCCC-3'

cdc20-IAA

5'-TCGACACTGCCCATCATAGCTGCGGAAGTTGAGTTCAGCACAGAAAGTA-3'

cdc20-ura

5'-GTTTCGTCAATATCACAAGCCTCGCCTGACCATGAGC-3'

cdc20-dw-R

5'-CGAACGTTTAAGAGCATG-3'

cdc20C-F

5'-GACATGGGGACCTTGGTG-3'

mcm10-IAA

5'-TCGACACTGCCCATCATAGCAGCGGAAGTTGAGGGAACTATTTCTAAGTC-3'

mcm10-ura

5'-GTTTCGTCAATATCACAAGCGACTTAGAAATAGTTCCC-3'

mcm10-dw-R

5'-GCTTACAAGCCCATCATACC-3'

mcm10C-F

5'-CCCTAAATCCTCTCTACC-3'

cdc45-IAA

5'-TCGACACTGCCCATCATCGTTCCTTGTGGTAGTGTTTTGAAGGACAGAC-3'

cdc45-ura

5'-GTTTCGTCAATATCACAAGCTCCACACCAGCAATTGTT-3'

cdc45-dw-R

5'-TGACTGATCCAGAATCGG-3'

cdc45C-F

5'-GCATCCCCTTGCGTTAAC-3'

orc2-IAA

5'-TCGACACTGCCCATCATCGTTCCTTGTGGTACGTCTTCCATCATATCC-3'

orc2-ura

5'-GTTTCGTCAATATCACAAGCGGACCCTTTTAGACTAGG-3'

orc2-dw-R

5'-TACAATGCTGATACTAGGA-3'

orc2C-F

5'-TCTCTATTCTTTGCCCGCC-3'

orc6-IAA

5'-TCGACACTGCCCATCATCGTTCCTTGTGGTGAAGCAGTACCATCTTTTTC-3'

orc6-ura

5'-GTTTCGTCAATATCACAAGCCGGGTACACGATATCTTTAG-3'

orc6-dw-R

5'-CAATGATTCTCAAGAGACG-3'

orc6C-F

5'-ACTAGTATCGGCAAAAGCTTTTG-3'

pol1-IAA

5'-TCGACACTGCCCATCATCGTTCCTTGTGGCGATGAAAATATCAGTCCC-3'

pol1-ura

5'-GTTTCGTCAATATCACAAGCCTACCCGTTTAAGTAATCTAC-3'

pol1-dw-R

5'-GTCAAACATGTAGTGAGTAC-3'

pol1C-F

5'-CTCATCTCAACTCAGAGA-3'

TIR1C-BmSc

5'-CGGGATCCGCGGAGACAGTGACTTAGGCAT-3'

TIR1-NLS-R

5'-CGGGATCCTTAGTCGACCACTTTGCGTTTTTTCTTTGG-3'

pol1N-nmt-F

5'-CTTATAGTCGCTTTGTTAAATCATATGAGAAAGAGAAACGCGGG-3'

pol1up-F-Spe

5'-GGACTAGTCGTGCTTCAAGTATTTCCCG-3'

pol1up-R-Bgl

5'-GAAGATCTGTTCACGAGAAGACTTTAAAG-3'

pol1dw-R-Bm

5'-CGGGATCCCGACCAGACGATCCTTTTTC-3'

cdc45up-F-Spe

5'-GGACTAGTCGTTGTGCACATGTTCACCT-3'

cdc45up-R-Bm

5'-CGGGATCCACGTTACTGGTGGTGGATCA-3'

ars2004 region-273F

5'-CGGATCCGTAATCCCACAAA-3'

ars2004 region-338R

5'-TTTGCTTACATTTTCGGGAACTTA-3'

nonARS1 region-514F

5'-TACGCGACGAACCTTGCATAT-3'

nonARS1 region-583R

5'-TTATCAGACCATGGAGCCCAT-3'


Kanke et al. BMC Cell Biology 2011 12:8   doi:10.1186/1471-2121-12-8

Open Data