Table 2

Primers for cDNA fragment cloning

Genbank acc no.

Gene

5'-Forward primer-3'

5'-Reverse primer-3'

Size

(bp)


NM_010701

ChM-I

GGGTCAATGGAAATAGATGCT

ACACCATGCCCAGGATGCGG

739


NM_011595

TIMP-3

GCTACTGCAGCTGGTACCG

TTGGACTTCTGCCAACTTCC

515


NM_013599

MMP-9

GATGCTATTGCTGAGATCCAGG

GGAAGATGTCGTGTGAGTTCC

433


NM_008864

Prl3d1

GACCTGTATACTCGTTTGGC

TCGTTCTGAAAGACAACTCG

551


NM_010088

Prl8a2

TGAATGTCAAACAGGAGAGAA

CAATCTTGCCCAGTTATGCGG

628


NM_001025250

VEGF-A

*GAAACCATGAACTTTCTGCTCTC

*GGTGAGAGGTCTGGTTCCCG

624


* The following sequence was added at the 5'-end of the primer. Added sequence: ATAAGAATGCGGCCGC

Miura et al. BMC Cell Biology 2011 12:34   doi:10.1186/1471-2121-12-34

Open Data