Table 1

Primers for RT-PCR analysis

Genbank acc no.

Gene

5'-Forward primer-3'

5'-Reverse primer-3'

Size (bp)


NM_010701

ChM-I

CATCGGGGCCTTCTACTTCT

CTGCGTCGTCCTGAACATTGGG

584


NM_010088

Prl8a2

TGAATGTCAAACAGGAGAGAA

CAATCTTGCCCAGTTATGCGG

628


NM_008864

Prl3d1

GCTTCCATCCATACTCCAG

TCGTTCTGAAAGACAACTCG

419


NM_009309

Brachyury

CTGCAGTCCCATGATAACTGGTCTAGC

CCAGGATTTCAAAGTCACATATATGTTGTAG

717


NM_009931

Col4a1

TGTCCAAGGCAACGAGCGTG

TGTTCTTCTCATGCACACTTGG

583


NM_007742

Col1a2

GAACGGTCCACGATTGCATG

GGCATGTTGCTAGGCACGAAG

401


NM_001025250

VEGF-A

CAGAGAGCAACATCACCATGC

TCCTCGAAGGATCTCCTCTTCC

313, 445


NM_010612

Flk-1

CACAGACACCACCGTGTACTCC

CTCCAAGGTAGACAGACTCGGC

516


NM_010228

Flt-1

TATGGTCTGTGTGCTTAGGTCG

ACAGGACCATCTATGGTCTTCC

476


NM_008006

FGF-2

AGCGGCATCACCTCGCTTCC

TGGAAGCAGTATGGCCTTCTGTCC

433


NM_010206

FGFR-1

AGAGACCAGCTGTGATGA

GGCCACTTTGGTCACACG

461


NM_010512

IGF-I

GGACCAGAGACCCTTTGCGGGG

GGCTGCTTTTGTAGGCTTCAGTGG

210


NM_010513

IGF-IR

ATGCTGTTTGAACTGCAGCGCATGTGCTGG

CCGCTCGAGCTTGCGGCCCCCGTTCAT

354


NM_010809

MMP-3

GAAATGCAGAAGTTCCTCGG

GAGTTCCATAGAGGGACTGA

878


NM_013599

MMP-9

TGTCATCCAGTTTGGTGTCG

TAGGGCAGAAGCCATACAGT

433


NM_008607

MMP-13

TGAAGAGACTGAGCGCTGCG

ATTCTTCCATGTGGTTCCAGCC

461


NM_008608

MMP-14

ATCATTGAGGTGGATGAGGAGG

CAGCCAACCAGGTACACTTGG

614


NM_001044384

TIMP-1

AGTAAGGCCTGTAGCTGTGCC

ACGAGGACCTGATCCGTCC

467


NM_011594

TIMP-2

AGCAGTGAGCGAGAAGGAGG

TCACTTCTCTCGATGCAGGC

450


NM_011595

TIMP-3

GCTACTGCAGCTGGTACCG

TTGGACTTCTGCCAACTTCC

518


NM008084

GAPDH

ACCACAGTCCATGCCATCAC

TCCACCACCCTGTTGCTGTA

452


Miura et al. BMC Cell Biology 2011 12:34   doi:10.1186/1471-2121-12-34

Open Data