Table 5

Target sequences corresponding to four unrelated genes from separate chromosomes

Amplicon

Chromosome

Forward Primer

Reverse Primer

Amplicon Length


GFAP

10

TCCAGCCCGTCCCTCAATAA

TCCCGAAGTTCTGCCTGGTAA

418 bp

CD23

12

TAGGAGACGATGCTGCTGTGCA

CGTGGGAAGAGGATCAGACAAGAA

284 bp

MPZ

13

CTTGCCCCTACCCCAGCTAT

TCTCCTTGGCTGGCTCTCAAT

184 bp

Fyn

20

ACACAATGCTGATCTAGTCGTGGC

CACATCTGTGTTCATCACTGTCCG

340 bp


Sets of primers and corresponding amplicon sizes defining target sequences in four unrelated genes located in different rat chromosomes. All the amplicons were designed for the 5' end of the corresponding gene.

Rivera-Mulia et al. BMC Cell Biology 2011 12:3   doi:10.1186/1471-2121-12-3

Open Data