Table 1

Sets of primers and corresponding amplicon sizes of target sequences

Amplicon

Forward Primer

Reverse Primer

Amplicon Length


A

TGGCAAACATACGCAAGGGA

GCGAAACACACCCCTGGAAA

275 pb

B

GAGGACAGTTAGTGCTGTAGGGTTG

CCTCCAACGAAGTTCCCAGAAT

547 pb

C

TCCTTTGTAACCAGGCAAGTGG

CCCATTTCCCAGATCCTTCACTCT

374 pb

D

CCCAGGGTCAGAGTATATCAGTGC

CGCTGAACGTATGTCTGAGTCA

305 pb

E

TGGTAGGCAGAGATGTGAGGAAAG

CCTGTTGTCCTAATGCTGGTCCTA

382 pb

F

CTGATCTTCAGGCAATATGGCAGG

TTGGCTGATGTCGTCTGGACA

393 pb

G

AAGGATAGGTGCTTGGCTGACA

GCCCTAACCCTGTGTGTGTATCTTG

504 pb

h

GATCACGTAACAACCCTGTCAGCT

CCTTCACAGCACCCGTCATACA

263 pb

i

GGTGCTGGGAATTTGACTAAGGC

TAAACTCAGGTGACAGGCTACGGC

465 pb

j

AGGAACCAGGGAATCGAGTGCT

AACTTGCGGGTGTTCTCTCCTT

392 pb

k

TGTCAGCATGATGGTGGCTCA

CTCGATTTGCCATGTCCTGTCT

252 pb

l

GGGCTGGGTCCATATTGCTTGA

ATGCTTTGGGCTTGCCTGAAG

373 pb

m

ACGACTTCCCTTCCTATCCACAG

GTAGAAAGTCGTTCTGGTTGCCAC

234 pb

n

CCCTAATCTTGCTGTGGTTTGG

TGAGAGCTGGGCAGACATCAA

355 pb

O

GGTGACAGTTGACAGAGAGCCTTC

GCTCCATGCTGACCTTGAAGTCTA

272 pb


Sets of primers and corresponding amplicon sizes defining fifteen target sequences along the 162 kbp genomic region of chromosome 14 containing members of the rat albumin gene family.

Rivera-Mulia et al. BMC Cell Biology 2011 12:3   doi:10.1186/1471-2121-12-3

Open Data