Table 2

Sequence of PCR primers

Gene

Sense

Antisense


Lipoprotein lipase

CTTCTGTTCTAGGGAGAAAGTG

TGCTGTGTAGATGAGTCTGATT


Osteopontin

GAAGGACAGTTATGAAACGAGT

AACATAGACATAACCCTGAAGC


PTH receptor

AACTACTACTGGATTCCTGGTGG

CTCCAAGATTTCTTGATCTCAG


Periecan

CATAGAGACCGTCACAGCAAG

ATGAACACCACACTGACAACC


Collagen type II

ACGGCGAGAAGGGAGAAGTTG

GGGGGTCCAGGGTTGCCATTG


ABCG2

CAAAACTTGCTGGGTAATC

ACAGAAACCACACTCTGACC


Nestin

CTCTGACCTGTCAGAAGAAT

GACGATGACACTTACAGAAT


Tuj1

CATGGATGCCGCTCAG

CAGGCAGTCGCAGTTTTCAC


MAP2

TGCCATCTTGGTGCCGA

CTTGACATTACCACCTCCAGGT


NFL

TCCTACTACACCAGCCATGT

TCCCCAGCACCTTCAACTTT


NFM

TGGGAAATGGCTCGTCATTT

CTTACTGGAAGCGGCCAATT


NSE

CTGATGCTGGAGTTGGATGG

CCATTGATCACGTTGAAGGC


GAP43

TCCTGAGCCCTGTCTCTCCCT

GCCACACTGTTTGACTTGGG


SNAP25

AGTTGGCTGATGAGTCGCTG

TGAAAAGGCCACAGCATTTC


GFAP

GCAGAGATGATGGAGCTCAATGACC

GTTTCATCCTGGAGCTTCTGCCTCA


CNPase

GGCCACGCTGCTAGAGTGCAAGAC

GGTACTGGTACTGGTCGGCCATTT


MaxiK

ACAACATCTCCCCCAACC

TCATCACCTTCTTTCCAATTC


Kv1.4

ACGAGGGCTTTGTGAGAGAA

CACGATGAAGAAGGGGTCAT


Kv4.2

ACCGTGACCCAGACATCTTC

CACTGTTTCCACCACATTCG


Kv4.3

GCCTCCGAACTAGGCTTTCT

CCCTGCGTTTATCAGCTCTC


EAG1

TGGATTTTGCAAGCTGTCTG

GAGTCTTTGGTGCCTCTTGC


EAG2

ACATCCTGCTTTTCGATTGG

CGGCTCTCTACCTGGCGTTG


NE-Na

GCTCCGAGTCTTCAAGTTGG

GGTTGTTTGCATCAGGGTCT


SCN5A

CCTAATCATCTTCCGCATCC

TGTTCATCTCTCTGTCCTCATC


CACNA1C

AACATCAACAACGCCAACAA

AGGGCAGGACTGTCTTCTGA


CACNA1G

CTGCCACTTAGAGCCAGTCC

TCTGAGTCAGGCATTTCACG


GAPDH

CATGACCACAGTCCATGCCATCACT

TGAGGTCCACCACCCTGTTGCTGTA


Jang et al. BMC Cell Biology 2010 11:25   doi:10.1186/1471-2121-11-25

Open Data