Table 3

Oligonucleotides used for mutagenesis reactions to alter NLSs sequences in TWIST.

Amino acid substituted in NLSs

Primer Sequence


K38R

5'CGCGGGGGACGCAGGCGGCGCAGCAGC3'

5'GCTGCTGCGCCGCCTGCGTCCCCCGCG3'

K73R

5'CCCAGGGCAGGCGCGGCAAGAAGT3'

5'ACTTCTTGCCGCGCCTGCCCTGGG3'

K76R

5'CAAGCGCGGCAGGAAGTCTGCGG3'

5'CCGCAGACTTCCTGCCGCGCTTG3'

K77R

5'GCGGCAAGAGGTCTGCGGGCT3'

5'AGCCCGCAGACCTCTTGCCGC3'


K, lysine; R, arginine

Singh and Gramolini BMC Cell Biology 2009 10:47   doi:10.1186/1471-2121-10-47

Open Data