Table 1

Polymerase chain reaction (PCR) primer sequences

GAPDH

F: CAACGAATTTGGCTACAGCA

R: CTGTGAGGAGGGGAGATTCA


CD34

F: ATTACACGGAAAACGGTGGA

R: AATTCGGTATCAGCCACCAC


Oct4

F: TCCCAGGACATCAAAGCTGCAGA

R: GTCAAACTTACGTACCCTCTCGGGTCT


NANOG

F: TACCTCAGCCTCCAGCAGAT

R: CATTGGTTTTTCTGCCACCT


SOX-2

F: TGGTTACCTCTTCCTCCCACT

R: GGGCAGTGTGCCGTTAAT


TENOMODULIN

F: GATCTTCACTTCCCTACCAACG

R: CTCATCCAGCATGGGGTC


DECORIN

F: GAATGAGATCACCAAGCTGC

R: TGAGATGCGAATGTATGAGAGA


LIPOCALIN

F: TTCTTCATCCACAAGATCCAG

R: AGTTGGGACACACATACCTCTT


Violini et al. BMC Cell Biology 2009 10:29   doi:10.1186/1471-2121-10-29

Open Data