Additional file 1:

Sequences and Sequence Landscapes of the PRS. The DNA sequence and SL of PRS_1 – PRS_5 is given, using l = 400.

Format: PDF Size: 20KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 2:

PCR reaction for the elements PRS_1. Column MW: 1 kb marker plus DNA Ladder. Size of the bands is indicated on the left. Column 1: amplification with primers: TTGTAAAACGACGGCCAGTG and CACACAGGAAACAGCTATGAC.

Format: PDF Size: 172KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 3:

Multiple alignment for PRS_1. Multiple alignment of read GenBank: EI185111 and read GenBank: EI185194, representing PRS_1.

Format: PDF Size: 6KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 4:

Multiple alignment of the Tan-PRS_1 elements. The tandem elements of PRS_1 were extracted from the original GSS. Elements A1-A11 were obtained from GenBank: EI185111; elements B1-B10 from GenBank: EI185194.

Format: PDF Size: 5KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 5:

Table of repeats of E. coli K12. The name, the number of copies and the size of the repeats that are present in the E. coli K12 genome are listed, with indication, which of those are detected by ReRep analysis, with the corresponding parameter values of l and t.

Format: PDF Size: 10KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 6:

FASTA file of repeats of E. coli K12.

Format: PDF Size: 97KB Download file

This file can be viewed with: Adobe Acrobat Reader