Table 4

Genes used in the qRT-PCR assays, and the sequence of the PCR primers used in the assays
Gene information Gene role Forward primer (5` to 3`)Reverse primer (3` to 5`)
UBE2Z, NM_023079.3 Reference gene GCAGAGCATGTCTGGCATAG TTCTCCTTCTGCCAAAACAAA
PGK1, NM_000291.3 Reference gene TGCATCTCCACTTGGCATTA TGGGATCTTGAAGAATGTATGC
SRRM1, NM_005839.3 Reference gene GGAAATCCTTGGGTTTGAAGA GGCCACAGTTCTCCCATAAA
COX4I1, NM_001861.2 Reference gene GGCACTGAAGGAGAAGGAGA GGGCCGTACACATAGTGCTT
B2M, NM_004048 DE gene determined by LO-BaFL/SAM GATGAGTATGCCTGCCGTGTG CAATCCAAATGCGGCATCT
ACTG1, NM_001614 DE gene determined by LO-BaFL/SAM AGAGGCTGGCAAGAACCAGTTGTT CAATGACGTGTTGCTGGGGCCT
DYNLT1, NM_006519.1 DE gene determined by TM4 analysis CCAGCCTATGGCCTTTCTCCTTTTGT CAACGCAGGCTGCAGGTGAC
SKIV2L2, NM_015360.4 DE gene determined by TM4 analysis TGCAGAAGGAATCACCAAAA ATGGGAGAACCAAATCCACA
C12orf35, NM_018169.3 DE gene determined by TM4 analysis CGGGGAAACAAGGTATTTGA TTCACATCACAGTGGGCATT
TARDBP, NM_007375.3 DE gene determined by TM4 analysis TTTGCTGCAGTTCTGTGTCC TCCATCTCAAAAGGTCAAAA
ILKAP, NM_030768.2 Cross-hybridizing gene with TARDBP CACAGGAGTACACAAAACACAC TGCGGATAGGGCACTGAG

Baciu et al.

Baciu et al. BMC Bioinformatics 2012 13:244   doi:10.1186/1471-2105-13-244

Open Data