Figure 4.

Specificity checking of pre-existing primers. This search was performed by entering the forward and reverse primers without entering any template. The primers (forward primer: GTAGGACTGCTCAGTTCAAACAT, reverse primer: ACAGTTACTACACCCGTAAGGC) were obtained from PrimerBank (http://pga.mgh.harvard.edu/primerbank/ webcite) on 11/02/2011 using ZNF419 transcript variant 5 (GenBank accession NM_001098494). While the results indicated all 7 transcript variants from the ZNF419 gene have the same amplicons, this figure shows the details only for variants 1 and 5 due to space limitation. The current search generated 11,236 BLAST hits (done on 11/02/2011).