Background
More than 30,000 people are diagnosed with oral cancer annually in the United States, and due to a poor survival rate that has remained relatively static, of those who are diagnosed, approximately 7,500 die of this disease each year
Risk factors are anything that significantly increases the chance of a person developing a disease, such as oral cancer. Scientists now agree that the use of tobacco and alcohol, human papillomavirus (HPV) infection, and in the case of lip cancers, exposure to ultraviolet light, are risk factors that increase the likelihood of developing oral cancers
It is generally accepted that fruit and vegetable intake may be correlated with a reduction in the incidence of oral cancers even among tobacco and alcohol users. The knowledge gained thus far, however, does not provide enough specific detail upon which to base effective or comprehensive nutrition or dietary intervention recommendations. More detailed information is needed to identify the active components of fruits and vegetables, to evaluate dose-response relationships, and to adjust for potential confounders. The stratification of these studies, for example, has revealed that citrus fruit consumption was associated with a larger protective effect against oral cancer than overall fruit consumption, and was greater than green- or overall vegetable consumption
Based upon these and other observations, a growing interest has been developing in alternative and complementary medicine to identify botanical and dietary components for their chemopreventive and chemotherapeutic potential. One such class of compounds, the proanthocyanidins (PACs), are polyphenolic compounds that are highly concentrated in certain dietary fruits and nuts, such as grapes, blueberries, cranberries, and almonds, as well as cacao beans and chocolate
PACs belong to a larger class of abundant, plant-derived compounds, flavonoids, which appear to provide many beneficial health effects, largely due to their antioxidant properties. PACs have been shown to protect against oxidative stress and tobacco-induced DNA damage, and to exhibit selective cytotoxicity against some human cancers, including breast, lung, prostate, and gastric carcinomas
The possible mechanisms of PACs effects on tumor proliferation are complex and are likely to involve multiple pathways, which may differ according to the type of cancer. For example, PAC derived from grape seed, green tea, and lowbush blueberry, exhibited broad, anti-proliferative properties against multiple cell lines, including colon
To further evaluate the potential relationship between oral cancer inhibition and PAC, we sought to identify any specific or dose-dependent effects that may exist between the administration of GSE-derived PAC and the proliferation of oral cancers. In this way, we hope to more definitively characterize the effects of this non-toxic agent for its chemopreventive or chemotherapeutic value. Quantitative and dose-dependent relationships between PAC administration and oral cancer proliferation could, therefore, be established prior to the identification and elucidation of the pathways involved, and prior to animal and
Based upon the observation that flavonoid-rich extracts, including PAC, inhibited proliferation of multiple tumor cell lines, this study examined the potential for PAC to modulate the proliferative phenotype of OSCC
We determined that PAC significantly reduced the proliferation of the OSCC cell line, CAL 27,
Our previous work established that infection of OSCC with high-risk HPV 16 strongly promoted the proliferative potential of OSCC
Standard chemotherapies and radiation treatment, frequently used to treat oral cancer patients, often have harsh and severe side effects that include tissue damage and malfunction. The discovery and validation of novel treatments and prevention strategies, lacking these harmful side effects, is one of our main short-term goals. This report provides evidence that PAC may provide one possible complementary or alternative therapy for oral cancer patients, as a safe, effective, cost-saving, and non-toxic treatment. We propose that this study provides compelling
Methods
Materials
Grape seed proanthocyanidin (PAC) extract (Lot #3717HF7361) was obtained from GNC Preventive Nutrition® (Pittsburgh, PA). This commercial source of PAC was extracted from U.S. grown wine grapes,
Cell lines and cell culture
Human oral squamous cell carcinoma (OSCC) CAL 27, human cervical carcinoma (CC) Ca Ski, human cervical adenocarcinoma (CAC) GH354, and human foreskin fibroblasts (hFF) Hs27 cell lines were obtained from American Type Culture Collection (ATCC: Manassas, VA). CAL 27, GH354, and Hs27 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) with 4.0 mM L-glutamine adjusted to contain 3.7 g/L sodium bicarbonate, 4.5 g/L glucose, and 110 mg/L sodium pyruvate, obtained from HyClone (Logan, UT). Ca Ski cells were maintained in RPMI-1640 medium with 2 mM L-glutamine, adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, obtained from ATCC. Media was supplemented with 1% Penicillin (10,000 units/mL)-Streptomycin (10,000 μg/mL) solution and 10% fetal bovine serum (FBS), obtained from HyClone, except that GH354 was supplemented with 20% FBS. Cells were cultured in 75 cm2 BD Falcon tissue-culture treated flasks (Bedford, MA) at 37°C and 5% CO2 in humidified chambers.
Transfection
CAL 27 cells were seeded in 25 cm2 BD Falcon tissue-culture treated flasks in appropriate media as described above and allowed to achieve 70% confluence. Cells were then transiently transfected by adding 1 μg/mL of the full-length HPV type 16 virus, cloned into the pBluescript SK-vector (ATCC #45113). The transfection was performed using the Stratagene Mammalian Transfection Kit (La Jolla, CA) according to the manufacturer's recommended protocol for CaPO4 transfection, and as previously described
Microscopy of cell morphology and viability
Cells were visualized with a Zeiss Axiovert 40 inverted microscope (Gottingen, Germany), and images were captured at 100× magnification with a Canon PowerShot G6 digital camera (Tokyo, Japan). Digital images were subsequently processed using Adobe Photoshop (San Jose, CA) Image Analysis tools. In brief, several wells of unstained Ca Ski, GH354, CAL 27, CAL 27-TF16, and Hs27 cells were photographed at each time point of the proliferation assays (day 1 – day 4) and at each concentration of PAC (0 – 100 μg/mL) to visualize any effects on cell morphology. In addition, several wells of cells were also fixed at these time points using 50 μL of 10% buffered formalin and subsequently stained using crystal violet 1% aqueous solution (Fisher Scientific: Fair Lawn, NJ) to quantitatively document cell morphology, percent of cell spreading, and confluence. Additionally, at each time point, several wells were stained using Trypan Blue (Sigma: St. Louis, MO) and live cells were enumerated to determine viability, as previously described
Proliferation
Statistics
The differences between treatments were measured using a
RT-PCR
RNA was isolated from 1.5 × 107 cells of CAL 27, CAL 27-mTF, and CAL 27-TF16, using ABgene Total RNA Isolation Reagent (Epsom, Surrey, UK) and the procedure recommended by the manufacture. RT-PCR was performed with the ABgene Reverse-iT One-Step RT-PCR Kit (ReadyMix Version) and a Mastercycler gradient thermocycler (Eppendorf: Hamburg, Germany) using the following primers synthesized by SeqWright (Houston, TX): HPV16 forward primer, ATGTTTCAGGACCCACAGGA; HPV16 reverse primer, CCTCACGTCGCAGTAACTGT. One μg of template RNA was used for each reaction. The reverse transcription step ran for 30 min at 47°C, followed by denaturation for 2 min at 94°C. Thirty-five amplification cycles were run, consisting of 20 sec denaturation at 94°C, 30 sec of annealing at 58°C, and 6.5 min of extension at 72°C. Final extension was run for 5 min at 72°C. Reaction products were separated by gel electrophoresis using Reliant 4% agarose gels (Cambrex: Rockland, ME). Bands were visualized by UV illumination of ethidium-bromide-stained gels and captured using a Kodak Gel Logic 100 Imaging System and 1D Image Analysis Software (Eastman Kodak: Rochester, NY).
DNA isolation
DNA was isolated from 1.5 × 107 CAL 27 and CAL 27-TF16 cells, cultured with and without PAC, with the GenomicPrep DNA isolation kit (Amersham Biosciences: Buckinghamshire, UK), using the procedure recommended by the manufacturer. DNA was separated by gel electrophoresis using Cambrex Reliant 1% agarose gels and the bands were visualized by UV illumination of ethidium-bromide-stained gels and captured using a Kodak Gel Logic 100 Imaging System and 1D Image Analysis Software.
Results
Cell morphology
To examine any anti-cancer properties of grape seed-derived PAC on oral cancers, we began these experiments with a series of
PAC-induced effects on cell morphology
PAC-induced effects on cell morphology
Our results demonstrated that both human cervical carcinoma lines, Ca Ski and GH354 (Fig.
PAC-induced effects on cell viability, cell spreading, and confluence
- PAC [0 μg/ml]
+ PAC [50 μg/ml]
% change
Cell viability (%)
Ca Ski
98
10
-88
GH354
96
15
-81
CAL 27
81
10
-71
CAL 27-TF16
95
27
-68
Hs27
99
73
-26
Cell spreading (%)
Ca Ski
99
5
-94
GH354
63
5
-58
CAL 27
85
5
-80
CAL 27-TF16
98
10
-88
Hs27
73
68
-5
Confluence (%)
Ca Ski
88
23
-74
GH354
50
26
-48
CAL 27
45
15
-67
CAL 27-TF16
51
11
-78
Hs27
56
25
-55
An examination of the OSCC cell line, CAL 27, revealed PAC-related changes in morphology that paralleled the changes that were observed for both cervical cancer cell lines (Fig.
Our previous work with CAL 27 demonstrated that transfection with HPV 16 increased the proliferation and induced the spreading of these cells, even when plated at low density
The non-cancerous fibroblast control cell line, Hs27 (Fig.
Proliferation
Ca Ski (CC) and GH354 (CAC)
To quantitate our observation that the administration of PAC may inhibit the proliferation of these cancer cell lines, in addition to the possible induction of apoptosis, the cervical carcinoma cell lines, Ca Ski and GH354, were grown in 96-well assay plates and their proliferation was measured over four days in three separate, independent experiments. Our results demonstrated that PAC elicited selective responses in the Ca Ski (HPV 16-containing) and GH354 (HPV 18-containing) cell lines. Low dose administration of PAC stimulated Ca Ski proliferation, while higher doses were inhibitory in a dose-dependent manner. All doses of PAC were inhibitory in GH354 cells, although the level of inhibition was determined to be dose dependent.
More specifically, Ca Ski cell proliferation was initially stimulated by the administration of PAC at the concentration of 10 μg/mL (+5%), while higher doses, between 20–100 μg/mL, had an opposite, inhibitory effect on proliferation (Fig.
PAC-induced effects on cell proliferation
PAC-induced effects on cell proliferation
The effects of PAC administration on GH354 cells produced slightly different proliferative responses compared with the effects on Ca Ski cell proliferation (Fig.
Hs27 (hFF)
A control cell line, Hs27, human foreskin fibroblasts, was also tested as described above. Our results demonstrated that Hs27 cells exhibited dose-dependent responses to PAC administration (Fig.
CAL 27 (OSCC) and CAL 27-TF16 (OSCC)
To test our hypothesis that PAC administration inhibits proliferation of OSCC, the OSCC cell line, CAL 27, was assayed and proliferation was measured over four days in three, separate independent experiments. Our results demonstrated that PAC induced variable responses, similar to the effects on Ca Ski cells, in a dose-dependent manner (Fig.
Our previous studies with OSCC proliferation revealed that CAL 27 cells proliferated more rapidly after transfection with HPV 16
To clearly delineate the results of our proliferation assays for CAL 27 and CAL 27-TF16, cells were plated in the presence of PAC dosages between 0 and GIMAX (50 μg/mL). Confirming our previous observations, PAC administration once again stimulated CAL 27 cells at the lowest concentration tested (10 μg/mL), but higher concentrations inhibited proliferation (Fig.
HPV 16 mediates the proliferation-inhibitory effects of PAC on OSCC
HPV 16 mediates the proliferation-inhibitory effects of PAC on OSCC. PAC dosage of 50 μg/mL was the GIMAX for both CAL 27 and CAL 27-TF16 cells. PAC doses greater than 20 μg/mL resulted in a net loss of cells in the CAL 27 assays, but was modulated by the presence of HPV 16 at dosages above 40 μg/mL in the CAL 27-TF16 assays.
Dose-dependent cell morphology responses
Even though we have described the dose-dependent inhibition of cellular proliferation in response to PAC administration through
Dose-dependent effects of PAC on proliferation and morphology
Dose-dependent effects of PAC on proliferation and morphology. Cells were plated in 96-well assay plates in media with FBS. The upper row (A-E) was grown without PAC, the mid-level row (F-J) in the presence of PAC at 20 μg/mL, and the lower row (K-O) under PAC administration at 50 μg/mL. All cell lines exhibited a dose-dependent response to PAC administration, with higher doses resulting in fewer cells at day 4. Ca Ski (A), CAL 27 (C), CAL 27-TF16 (D) and Hs27 (E) cells were reduced in number with PAC at 20 μg/mL (F, H, I, J), unlike GH354 cells (B), which experienced a reduction in proliferation, and morphological changes indicative of apoptosis (G). Cellular proliferation was reduced by PAC in all cell lines (K-O) at 50 μg/mL; all cell lines exhibited altered morphology, except Hs27 (O) cells which appeared normal, although fewer in number.
Inhibition of proliferation was induced by treatment of cells with low concentrations of PAC, sustained over time (Fig.
Higher concentrations of PAC, on the other hand, elicited different responses in cell morphology and appearance. Cell clustering and rounding was induced in all cancer cell lines (K-N) with PAC (50 μg/mL). Possible evidence of apoptosis at this concentration was first observed in all cell lines, except Hs27 (Fig.
The cervical carcinoma cell line, Ca Ski (Fig.
Nucleic acid analysis
To confirm that the CAL 27 cells used in this study did not harbor HPV 16 prior to transfection, we performed RT-PCR on total RNA isolated from cultured CAL 27 cells used for these experiments and oligonucleotide primers specific for the HPV 16 strain (Fig.
Total RNA and DNA analysis of CAL 27 cells
Total RNA and DNA analysis of CAL 27 cells. RT-PCR performed on total RNA extracted from OSCC, CAL 27, revealed that CAL 27 did not express HPV 16-specific mRNA (A: Lane 1). Mock transfectants (A: Lane 2) also did not express HPV. HPV 16-transfected cells (A: Lane 3) expressed HPV 16; specific primers were tested using PCR and the full-length HPV 16-DNA template (A: Lane 4). Total DNA isolated from CAL 27 cells (B: Lane 1) and CAL 27-TF16 cells (B: Lane 3) demonstrated DNA alterations following PAC treatment (50 μg/mL), including a more diffuse banding pattern and lower molecular weight, possibly indicating the onset of DNA fragmentation among the treated cells (B: Lane 2, 4).
The administration of PAC had multiple effects, including a dose-dependent reduction in cellular proliferation and changes in cellular morphology among cancer cell lines. This study also assessed total DNA isolated from CAL 27 and CAL 27-TF16 cells in the absence and presence of PAC at 50 μg/mL (Fig.
Discussion
Proanthocyanidins are part of a larger group of compounds that have been demonstrated to have anti-proliferative and anti-tumor effects
Although other studies have demonstrated that particular fractions of GSE or raspberry extracts may be cytotoxic against oral tumor cell lines, none have yet examined PAC specifically to analyze its effects on oral cancer proliferation. Through this study, we have demonstrated that PAC exhibited dose-dependent inhibitory and cytotoxic effects on cervical cancer cell lines, with these effects more selective and intensely specific for OSCC. In addition, HPV, now believed to initiate oral cancers among non-smokers, and to modulate OSCC proliferation and progression among smokers, was modulated and reduced, in a dose-dependent manner, by the administration of PAC.
A closer examination of PAC administration among these various cell lines revealed that the effects of PAC were less intense and more gradual in the foreskin and cervical cancer cell lines, Hs27 and Ca Ski, respectively. In contrast, at even the lowest dosages, PAC substantially inhibited the proliferation of both the cervical cancer cell line, GH354, and the OSCC cell line, CAL 27. Furthermore, the level of inhibition was dissimilar between these two cancers – only limiting proliferation of the cervical cell line, GH354, but resulting in a net loss of cells in the oral cancer line, CAL 27. This level of cytotoxicity may represent a selective effect which suggests that OSCC may be rendered more susceptible to this treatment.
Although we found that PAC exhibited a general inhibitory effect on all cell lines tested, a morphological change was observed after PAC administration in both the cervical and oral cancer cell lines that suggested the possible induction of apoptosis. Images obtained from live cell cultures under PAC administration demonstrated that many of the cells were clustering, rounding, and blebbing – morphologic changes that are often suggestive of apoptosis. However, once the cells were fixed and stained to quantify these effects on proliferation, only Ca Ski cells and non-cancerous controls Hs27 were sufficiently adhered to remain in the assay plates at the GIMAX concentration of PAC. One possible reason for this phenomenon may be the degree of progression toward apoptosis or cell death; the more susceptible cell lines, such as GH354, CAL 27, and CAL 27-TF16, could be further along the apoptotic pathway and therefore less capable of adhering and more likely to be removed by mechanical forces during the fixation and staining process. The DNA analysis revealed fragmentation, but no banding patterns indicative of internucleosomal cleavage, suggesting further experimentation will be necessary to delineate the pathways and mechanisms associated with these changes.
Aside from demonstrating that PAC may exhibit differential effects among different cancers, we found convincing evidence that HPV may modulate, and in turn be modulated by, the effects of PAC with respect to the OSCC proliferative response. Our previous research found that HPV 16 strongly induced OSCC proliferation and our findings here indicate that HPV 16 also influenced OSCC response under PAC administration. The introduction of HPV 16 into these cells not only increased their relative levels of proliferation, but also mediated their response to PAC, with lower dosages actually stimulating proliferation of CAL 27-TF16 cells. Interestingly, the GIMAX was determined to be invariable for both transfected and non-transfected cells, suggesting that despite this modulating effect, the HPV 16-specific effect was not sufficient to alter OSCC proliferation in response to incremental increases of PAC administration at or beyond GIMAX.
One critical goal of cancer treatment is to find chemopreventive and therapeutic agents that selectively target cancer cells without detrimental effects to healthy cells and tissues. Although many chemotherapeutic agents are currently being used in the treatment of oral cancers, such as cisplatin (CDDP) and 5-fluorouracil (5-FU), it is known that most tumors may be more or less resistant to these drug therapies because they are not dependent on a single receptor or signal transduction pathway for growth and progression
Recent studies have determined that PACs can be administered orally as a dietary supplement and are subsequently bioavailable, in both serum and tissues at μg/mL concentrations, without any significant toxicity, implying that PACs may represent one class of promising candidates for use as an adjuvant therapeutic agent in patients receiving chemotherapy for oral cancer
Conclusion
PAC-containing commercial products, such as ActiVin®, OptiBerry®, Grape Seed Proanthocyanidin Extract, and others, have been verified as well-tolerated and non-toxic
Competing interests
The author(s) declare that they have no competing interests.
Authors' contributions
KK and SO conceived, monitored and coordinated the experimental design. SO, MK, KC, DF, DJ, JP and AS carried out the transfection, cell culture, and proliferation assays. Both KK and SO contributed equally to the writing of this manuscript. All authors have read and approved the final manuscript.