A total of 60 subjects from the Stanley Foundation Neuropathology Consortium were used in these studies. This set consists of 15 samples from patients with schizophrenia, 15 with major depressive disorder, 15 with bipolar disorder, and 15 matched controls patients. A detailed description of this collection has been published 12, and a summary of subject characteristics is shown in Table 1.

Cryostat and paraffin sectioned slides were provided by the Stanley Foundation. They were stored at -80°C and room temperature, respectively, until use. The sections were coded, the investigator had no knowledge of the disease state of the tissue and the experiments were conducted 'blind'.

Anti-Oct-6 antibody 1 : rabbit polyclonal against the N-terminal region of mouse Oct-6 protein (98% homology in human), hereafter referred to as anti-Oct-6 (N). Antibody characterisation and specificity has been previously described 4.

Anti-Oct-6 antibody 2 : rabbit polyclonal against full-length Oct-6 purified from baculovirus infected Sf9 cells hereafter referred to as Anti-Oct-6(FL). Antibody characterisation and specificity has previously been described [13].

Slides were dewaxed using xylene, rehydrated and endogenous peroxidase activity was blocked by washing in 0.3% H₂O₂. Following PBS (phosphate buffered saline) washes, slides were incubated in normal swine serum (1:10 in PBS; Dakocytomation) for 30 mins then incubated at 4°C overnight in Anti-Oct-6(N) (1:500). Slides were then incubated in anti-rabbit secondary (1:500 in PBS; Dakocytomation) for 2 hours. Slides were washed then incubated in ABComplex (Dakocytomation) for a further 2 hours in the dark. Colour was developed using DAB (3, 3'-diaminobenzidine, Vector Laboratories). The reaction took 5–10 minutes and was considered complete when a brown colour was observed on the slides. When suitable colour had developed, the DAB reaction was stopped by washing slides in dH₂O, slides were air dried and mounted using Faramount aqueous mounting medium (Dakocytomation).

Slides were post fixed for 10 minutes in acetone (-20°C) for 10 minutes, air dried and washed in PBS (4°C) for 5 minutes and 0.3% H₂O₂ for 10 minutes. Slides were blocked for 30 minutes in a 1:10 (in PBS) solution of Swine serum (Dakocytomation) and incubated overnight at room temperature in anti-Oct-6(FL) (1:3000). Slides were washed then incubated in anti- rabbit secondary antibody (1:500, Dakocytomation) for 2 hours. Signal amplification and visualization using ABC and DAB was as described above.

In situ hybridization was conducted using a 1.6 kb DIG labelled probe complementary to the 3' untranslated region of the Oct-6 gene.

Forward primer: GTGGTGGTGGTGGTGGTGTGTGACGGG

Reverse primer: ACAGCCCTGGGGTACATGTTTATGTGAGTAATAAAAT

Amplicon: 1646 bp

Slides were placed in 4% fomaldehyde at room temperature for 10 mins then washed in DEPC-PBS then in 0.1 M triethanolamine, pH 8.0/acetic anhydride, 400: 1 (vol: vol), on a stir plate for 10 min. Slides were then incubated in pre-hybridization solution (50% formamide, 5 × SSC, 5 × Denharts, 250 μg/ml bakers yeast RNA and 500 μg/ml Herring sperm DNA) for 2–4 hrs at room temperature in a humidified chamber. Slides were incubated in hybridization solution (pre-hybridization solution with probe added at a typical concentration of 1:500), covered with a coverslip and incubated at 60°C for approximately 18 hours. Sense-strand probes were used as specificity controls for hybridization and revealed no binding.

Coverslips were removed by washing in 5 × SSC at 65°C, then the slides were washed in 2 × SSC at 65°C for 30 mins, 0.2 × SSC at 65°C for 30 mins, then in Buffer 1 (0.1 M Tris pH7.5, 0.15 M NaCl) for 5 mins then incubated in block (10% heat inactivated sheep serum in Buffer 1) at room temperature for 1 hour then finally incubated in alkaline phosphatase-conjugated sheep anti-DIG antibody (Roche) at room temperature for 4 hours. Following washed in Buffer 1 and Buffer 3 (0.1 M Tris pH9.5, 0.1 M NaCl, 50 mM MgCl₂, 2 mM levamisole), hybridization was visualized by enzyme catalysed colour reaction using nitro blue tetrazolium salt (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) (Roche). Reaction was stopped in PBS and then water, slides were air-dried and mounted using Faramount aqueous mounting medium (Dakocytomation).

All sections were analysed with a Nikon light microscope (Eclipse 600) with Lucia 4.0 image analysis software.

We attempted to detect OCT-6 immunoreactivity in hippocampus and cortex in post-mortem human brains. We performed immunohistochemistry on a series of 22 paraffin sections from the hippocampal formation taken from a total of 20 brains from all four groups under study (schizophrenia (n= 9), major depression (n = 3), bipolar disorder (n = 3), and control (n = 5)), using the antibody (Anti-Oct-6 (N)) and staining procedure as in the previous study 6. In each case, we found OCT-6 expression in all fields (CA4, CA3 and CA1) of the hippocampal formation (Figure 1). OCT-6 immunoreactivity was restricted to large cells with the morphology of pyramidal neurons and appeared to be localised to the perinuclear region of the cytoplasm. There was no distinguishable difference in intensity of staining between different hippocampal fields.

Immunoreactivity was also noted in the cerebral cortex where it assumed a layer-specific pattern, appearing restricted to pyramidal neurons of layers II/III and V (Figure 2). Cells in layer II/III were more intensely stained than those in layer V. OCT-6 expression in all cortical neurons generally appeared to be dispersed throughout the cell, although a few neurons in layer II/III were noted to have the cytoplasmic/perinuclear localization seen in hippocampal cells (Figure 2A (arrowhead)). This laminar distribution in the neocortex is consistent with the pattern described in adult rodents 3.

Thus, in contrast to the previous study 6, we observed OCT-6 immunoreactivity in hippocampal field CA1 and were unable to detect any difference in OCT-6 expression between control and schizophrenic specimens, as all the control specimens we examined (n = 5) displayed Oct-6 immunoreactivity.

The immunoreactivity in the paraffin sections was predominantly cytoplasmic. Though this has been reported in earlier studies [6, 14], it is nonetheless noteworthy since Oct-6 being a transcription factor would be expected to be nuclear. It was deemed possible that the fixation may be affecting antibody penetration. In order to investigate this further, immunohistochemistry was conducted on fresh frozen sections. We were unable to observe any immunoreactivity in unfixed specimens using the anti-Oct-6 (N) antibody. We were, however, able to observe robust, reproducible staining using the anti-Oct-6(FL) antibody. Oct-6 immunoreactivity was observed in a subset of cells in hippocampal fields CA4, CA3, CA1 in all groups (Figure 4). As with the paraffin sections, staining appeared restricted to pyramidal neurons. Not all specimens had Oct-6 immunoreactive cells, but in each group the majority of specimens were positive (6 of 7 control specimens, 8 of 8 schizophrenic specimens, 6 of 7 bipolar specimens and 7 of 8 major depression specimens). There was no significant difference in the proportion of positive specimens between groups.

In all positive cases staining was evident throughout the hippocampal formation from CA4 to CA1, but different fields showed different degrees of immunoreactivity with the most intense staining generally appearing in CA1.

Differences in staining localization between the different hippocampal fields were apparent. In some specimens, Oct-6 immunoreactivity in CA4 and CA3 was present throughout the neuron cell body (Figure 3A (asterisks), whilst in others it was predominantly nuclear (Figure 3D, E, J and 3K (arrows). Immunoreactivity was also noted in the apical dendrites of some cells (Figure 3B (arrowheads). In all cases the intense staining seen in the CA1 region was predominantly nuclear (Figure 3C, F, I, L and 3O). These differences in localization did not appear to be particularly associated with any of the four groups under study.

In order to determine areas of Oct-6 gene expression, ISH was performed using a probe complementary to the 3'UTR of the Oct-6 gene. Oct-6 mRNA expression was observed in the cortex and all hippocampal fields in specimens from all four groups (Figure 4). As with immunoreactivity, the majority of specimens in each group were positive (9 of 14 control specimens, 9 of 15 schizophrenic specimens, 9 of 14 bipolar specimens and 9 of 14 major depression specimens). Thus, the proportion of positive specimens was almost identical in each group.

Although levels of immunoreactivity varied between hippocampal fields, the ISH signal appeared to be at similar levels throughout, being equally intense in the CA4 as the CA1 cells. There were some positive cells in cortical regions, but intensity here was much reduced. In the cortex the expression of Oct-6 mRNA was confined to layers II/III and V, similar to the Oct-6 immunoreactivity described above.

Kruskal-Wallis non-parametric tests revealed significant differences between groups with regards to the length of time tissue had spent either in formalin or in frozen storage (df = 3 p = 0.017 and df = 3, p = 0.005 respectively) in each case the control samples had spent shorter amounts of time in each.