Development of sporadic colorectal adenomas and carcinomas has been associated with several lifestyle factors, including cigarette smoking 12. Cigarette smoke contains a large number of carcinogens, which may bind to DNA and form adducts, potentially causing irreversible genetic damage in the normal colorectal mucosa 345. The large bowel is exposed to these compounds through the circulatory system 1, and it has been proposed that the first hit in colorectal cancer (CRC) development is most likely caused by blood-borne carcinogens in the colonic crypt 6. This makes carcinogens from tobacco smoke a potential source. A number of case control studies have shown a strong correlation between cigarette smoking and the risk of developing adenomas, but the evidence linking cigarette smoking and CRC has been inconsistent 1. Cigarette smoking as the initial cause of CRC may require a smoking history as long as 40 years 17. In studies conducted prior to 1970 only a limited number of smokers would have exceeded four decades of smoking. This has been proposed as an explanatory factor for the inconsistent results in linking cigarette smoking to CRC development 1.

Another explanation for this discrepancy is that cigarette smoking is only involved in tumors with specific genetic mutations. So far, the genetic targets of carcinogens from cigarette smoking in CRC development have not been fully elucidated. It is possible that several genes in different molecular pathways are affected. CRC development may take at least two different pathways based on genomic instability. The majority of sporadic cases display chromosomal instability (CIN) while microsatellite instability (MSI) with mutations in mismatch repair genes is displayed in about 15% 8. CRC tumors displaying MSI have been positively associated with cigarette smoking in four studies while one study detected no such association 910111213. The CIN pathway involves mutations in several genes including adenomatous polyposis coli (APC), k-ras and TP53. As a target gene for initiation, APC fits the profile with its "gatekeeper" function in the colonic mucosa 141516. APC is a tumor suppressor gene in the Wnt signaling pathway, and it regulates cell proliferation mainly through its association with β-catenin 17. Mutations in the APC gene have been detected in the majority of adenoma and CRC cases 16181920212223. The so called "mutation cluster region" (MCR), codons 1286 – 1513, represents <10% of the APC gene, but previous studies have shown that as much as 60–70% of the somatic mutations occur in this region 20212425. A truncation mutation in the MCR region of the APC gene will result in a protein that lacks most of its 20-amino acids β-catenin binding and down regulation sites.

Only two case-control studies have to our knowledge investigated the association between cigarette smoking and APC truncation mutations in CRC development 1011. They reported no association when focusing on "ever smoking", "starting smoking > 35 years ago", "high dose or long duration", but interestingly they detected an inverse association for "starting smoking < 35 years ago" 11, and "first starting smoking after age 25" 10. A smoking parameter of "years since starting smoking", which precedes the initiating point for CRC development, might therefore be important when evaluating APC mutation and CRC risk.

Most studies have focused on truncation mutations. Even though the biological significance of missense and silent mutations are uncertain, the mutational spectra of the APC gene may provide a more complete picture of impact and type of carcinogenic exposure.

In this Norwegian case-control study, the KAM cohort, we used direct sequencing of the APC MCR to evaluate the mutational spectra of the gene in relation to smoking history in both colorectal adenomas and carcinomas. We also investigated the overall adenoma and CRC risk in association with several smoking parameters. The same investigation was further conducted after dividing the case groups based on APC truncation mutation status with a particular focus on CRC and years since starting smoking.

The KAM cohort (Kolorektal cancer, Arv og Miljø) is based on the screening group of the Norwegian Colorectal Cancer Prevention study (The NORCCAP study) in Telemark 26, and a series of colorectal cancer cases from the same region (Telemark) operated on at Telemark Hospital in Skien. The KAM biobank has previously been described 27. The KAM cohort is based on an ethnic homogeneous group of Norwegian origin. The ID number for the NORCCAP study at Clinicaltrials.gov is – I NCT00119912 28. Those invited to participate in the NORCCAP study were 20,780 men and women, age 50–64 years old, drawn by randomization from the population registry. The overall attendance rate was 65%. The 48 adenoma cases with severe degree of dysplasia and a control group of 334 individuals were drawn from the NORCCAP study. All the controls in the KAM cohort that completed the questionnaire were included. The controls were screen negative participants (negative flexible sigmoidoscopy). For CRC cases, all patients diagnosed with colorectal cancer who were mentally competent to complete the questionnaire were asked to participate in the KAM study. The questionnaire contained information on a family history of cancer and the included CRC cases had no known personal history of cancer. In this study 94 CRC cases were drawn from the KAM cohort. The tumor histology of the carcinomas and adenomas was examined independently by two specialist histopathologists in order to determine the tumor stage. The Regional Ethics Committee and the Data Inspectorate have approved the KAM study.

Sequencing was performed on DNA isolated from formalin-fixed, paraffin-embedded colon tumor tissue, collected prior to chemo- or radiotherapy treatment (> 60% tumor cells) using a GenoPrep™ DNA Isolation from Tissue kit (GenoVision). The analysis covers codons 1260 – 1585, including all the codons in the extended MCR, residues 1281 – 1556 29. The reference sequence for human APC is Genbank Accession Number M74088. The MCR region was divided into five overlapping fragments and amplified separately in two consecutive PCRs. The first fragment is 297 bp, codons 1260 – 1358. The PCR primers are: Fragment 1.1: (1246–1358) forward – AAGTGGTCAGCCTCAAAAGG, reverse – CGCTCCTGAAGAAAATTCAAC, and fragment 1.2: (1260–1358) forward – CAGACTTATTGTGTAGAAG, reverse CGCTCCTGAAGAAAATTCAAC. The PCR reaction mixture (total volume 50 μl) contained 50 ng DNA, 0.4 μM of each primers, 0.2 mM dNTP's, 1× PCR buffer, 2–3 mM MgCl₂ and 0.5 U Taq DNA polymerase. The reaction conditions for the first PCR: Fragment 1.1: 5 cycles of 30 s at 94°C, 45 s at 56°C, 1 min 70°C, followed by 25 cycles of 30 s at 94°C, 45 s at 54°C, 1 min 70°C followed by 5 min at 70°C. The primers and reaction conditions for the second PCR and remaining four fragments, each 220 bp long, and primers and reaction conditions have been described elsewhere 18. All products from the five different fragments were purified with Min Elute PCR Purification Kit (Qiagen) before sequencing. The sequencing was performed on ABI 310 automatic sequencer using Big Dye Terminator v 1.1 Cycle Sequencing kit (Applied) by standard protocol and primers from the second PCR. In 10 of the CRC cases and 8 of the adenoma cases one or more fragments of the sequenced region of the APC gene could not be amplified. Some of these cases had mutations in the amplified fragments and these mutations were included in evaluating the mutational spectra of the gene. For case-control comparison all cases with detected truncation mutation were used. Cases that showed no mutations and or failed in amplification were left out of the data analysis.

In order to validate the sensitivity of our sequence analysis of paraffin-embedded tissues, we compared analysis performed on the same samples using DNA from both blood and paraffin-embedded tissue on a specific region of the APC gene. The G4497A silent polymorphism is located in the MCR of APC. We used the amplified products from fragment 4.2 and the restriction enzyme BtgI to cut the wild type allele in order to identify samples that were homozygot for the wild type and the polymorphism, respectively. The cutting conditions were 1× NE-buffer, 0.3 mM BtgI with a total volume of 11 μl and 4 μl of PCR product. The samples were incubated over night at 37°C. The detection limit of the mutational analysis was determined by mixing the homozygous PCR product for the polymorphic allele with increasing concentrations of the corresponding wild type allele, and sequencing these mixtures on the ABI 310 as described for the samples.

All of the participants were requested to fill in a self-administered questionnaire on dietary and personal history, including smoking habits and family history of cancer. Smoking habits were assessed as current smoking status, number of cigarettes smoked per day, total number of years smoked, age of starting smoking, and if applicable the age at which the participant stopped smoking 303132.

Differences in characteristics between groups were assessed using the χ²test for categorical variables and the Mann-Whitney test for continuous variables; p values < 0.05 were considered significant. We examined by logistic regression the association between smoking and development of colorectal adenomas and carcinomas measured separately as odds ratio (OR) with 95% confidence interval (CI). The controls used as a reference group in this study of adenomas and carcinomas are matched to the cases by region (Telemark). An overall case-control comparison was conducted as well as separately comparing cases with or without APC truncation mutation (APC ⁺ and APC ^-, respectively), to the polyp-free controls in relationship to smoking history. Case-case comparison was conducted to evaluate heterogeneity in risk factors. The risk factors evaluated were: cigarette smoking status (never, ever), number of cigarettes smoked per day (≤15; > 15), duration of smoking in years (≤ 30; > 30), and years since first starting smoking (≥ 40 years ago). MiniTab Statistical Software, Release 13.1 Xtra (Minitab Inc.) was used for statistical calculations. The data are age and sex adjusted.

In this study direct sequencing was used to identify adenomas and CRC tumors with or without any APC mutations in the MCR region of the gene, and the results were compared to history of smoking. The overall adenoma and CRC risk as well as cases divided based on APC truncation mutation status, were assessed according to several smoking parameters.

We detected fewer APC silent/missens mutations than a resent Dutch study did 33, but the frequencies of truncated mutations detected for CRC and adenomas are comparable to published studies on APC truncation mutations (30–45%) 111618212333. The location and type of mutations detected (data not shown) are also consistent with those reported in the APC database 34. The KAM study is to the best of our knowledge the first study to evaluate the association between colorectal adenomas, APC mutations and smoking history, and also to evaluate the complete mutational spectra of APC in CRC cases in relation to smoking history.

We detected no significant difference between the adenoma and CRC case groups, or between ever and never smokers in relation to frequency and type of mutation. A Japanese study reported similar APC truncation mutations frequencies 35. With the exception of one A → T transversion all the truncated point mutations detected were G:C → T:A transversions and C → T transitions. The silent/missense mutations displayed a more heterogenous mutational spectra.

For overall case-control comparison a statistically significant association was detected for CRC cases and "duration of smoking > 30 years", OR = 2.86 (CI 1.06–7.7). The fact that the CRC cases and controls have not been matched by age may affect the result of the analysis, but the result is comparable to other studies published in recent years 1. The selection of controls is vital, and our controls have all been screened in the colon and found to be polyp free at flexible sigmoidoscopy. It has been estimated that the risk of erroneously classifying individuals with proximal advanced neoplasia as neoplasia-free is less than 3% at flexible sigmoidoscopy 36. No significant association was observed for adenomas and smoking history. This may be due to low sample size.

When dividing adenoma cases based on APC truncation mutation status a statistically significant association was detected for "ever smoked" and APC^- adenomas only. This implies the involvment of other genes in association with cigarette smoking and adenoma development. Both the MSI pathway and other CIN genes such as k-ras have previously been associated with cigarette smoking and CRC development 910111213. The results may also indicate the importance of the smoking parameter when evaluating APC. If APC truncation mutations are involved in the initiating process, this association may be lost or diminished when using a parameter without time frame of exposure. For adenomatous polyps both latency period for adenoma development, and which ones will develop into cancerous tumors is difficult to predict. It is interesting that when comparing the adenoma and CRC case groups to different smoking parameters, mean years since starting smoking is the only parameter that is statistically significantly different between the two case groups, P < 10^-4. Although, our adenoma case group is small, all have been diagnosed with severe degree of dysplasia. The advanced adenoma, defined by high-grade dysplasia, size > 1 cm or villous features, has a greater potential of developing into a cancerous tumor than small adenomas with mild or moderate dysplasia 37.

For CRC cases divided based on APC truncation mutational status all smoking parameters, except "starting smoking ≥ 40 years ago", were associated with APC^- cases. For "duration of smoking > 30 years" this association was statistically significant, OR = 4.06 (1.20–13.7). For APC ⁺ cases no significant association was detected, but "duration of smoking > 30 years" and "starting smoking ≥ 40 years ago" showed an association. This may indicate that cigarette smoking is associated with tumors without APC truncation mutation, as reported in two previous published studies by Diergaarde et al 11 and Lûchtenborg et al 10. These findings are comparable to the obtained results for adenomas. As previously discussed, this may imply the involvment of other genes in association with cigarette smoking and colorectal carcinogenesis. Sporadic CRC is a complex disease and several environmental factors in combination with genetic make up may have an impact on CRC development. The chromosomal instability (CIN) pathway involves several genes including APC, k-ras and TP53 141516. It has been reported that smoking may be associated with k-ras transversion mutations and play a role in TP53 negative tumors in CRC 11. The other major pathway for CRC development involves microsatellite instability (MSI) 8. Slattery et al reported that MSI positive cases are more likely to smoke more than 20 sigarettes a day 9 and CRC tumors displaying MSI have been positively associated with cigarette smoking.

However, smoking parameters like amount and duration of smoking may not be the correct measures in validating initiating causes for CRC development. Diergaarde et al also reported a statistically significant inverse association between CRC cases with APC truncation mutation and "starting smoking ≤ 35 years ago" (OR 0.02, CI 0.1–0.8) 11, and Lûchtenborg et al reported an inverse association between "age first smoked ≥ 25 years" and CRC cases with APC truncation mutation (OR 0.54, CI 0.26–1.10) 10. These results indicate that a sufficiently long time since first exposed to cigarette smoke is important in order to evaluate the association of smoking, APC mutation and CRC development. For cigarette smoking to be the initiating factor a latency period of approximately 40 years has been proposed 7. In this study the case-case (APC⁺ versus APC^-) comparison of CRC cases showed no association or an inverse association for all smoking parameters, except "starting smoking ≥ 40 years ago" with an OR = 2.24 (CI 0.73–6.86). This result is in concordance with the theory of APC truncation mutations in the initiating phases of CRC development. In addition, "starting smoking ≥ 40 years ago" was the only smoking parameter that was significantly different for APC ⁺ and APC^- CRC cases, P = 0.010. This parameter (starting smoking ≥ 40 years ago) highlights the importance of the particular point in time when starting smoking. There was no difference between the two CRC subgroups when comparing dose and duration.

Our results indicate that there is an association between cigarette smoking and adenoma and CRC development. For cases divided based on APC truncation mutation status this association was strongest for cases without mutation. This indicates that there are other factors that may play a major role in development of these tumors. The exception was for a smoking history with a time span of 40 years or more since first starting smoking. This smoking parameter was only associated with cases with APC mutations, though this association was not statistically significant. This may suggest that smoking can contribute to CRC development through mutations in the APC gene if smoking starts prior to CRC initiation. A larger study would be required to clarify this issue.

The author(s) declare that they have no competing interests.

MS extracted samples, performed the sequencing analysis on the APC gene and prepared the first draft of the paper. She did the data analysis. CFS contributed with technical advice on the sequencing of the APC gene and design of primers. She also contributed to the manuscript and with advice in the data analysis. RB performed in the sequencing of the adenomas and sensitivity analysis. IMBL did the pathology including the selection of sections for DNA extraction. PCH contributed with statistical advice. GB collected tumor tissues. ILH participated in collection and quality control of the questionnaires. EHK brought the idea and organized the study. She contributed with advice on the data analysis and was responsible for the revisions of the paper. All authors discussed the results, contributed to interpretation of the results and the final manuscript.