<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2407-6-19</ui>
   <ji>1471-2407</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p><it>BACH1 </it>Ser919Pro variant and breast cancer risk</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Vahteristo</snm>
               <fnm>Pia</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>pia.vahteristo@helsinki.fi</email>
            </au>
            <au id="A2">
               <snm>Yliannala</snm>
               <fnm>Kristiina</fnm>
               <insr iid="I1"/>
               <email>kristiina.yliannala@ktl.fi</email>
            </au>
            <au id="A3">
               <snm>Tamminen</snm>
               <fnm>Anitta</fnm>
               <insr iid="I1"/>
               <email>anitta.tamminen@hus.fi</email>
            </au>
            <au id="A4">
               <snm>Eerola</snm>
               <fnm>Hannaleena</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>hannaleena.eerola@fimnet.fi</email>
            </au>
            <au id="A5">
               <snm>Blomqvist</snm>
               <fnm>Carl</fnm>
               <insr iid="I3"/>
               <insr iid="I4"/>
               <email>carl.blomqvist@hus.fi</email>
            </au>
            <au id="A6">
               <snm>Nevanlinna</snm>
               <fnm>Heli</fnm>
               <insr iid="I1"/>
               <email>heli.nevanlinna@hus.fi</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Departments of Obstetrics and Gynecology, Helsinki University Central Hospital, Helsinki, Finland</p>
            </ins>
            <ins id="I2">
               <p>Department of Medical Genetics, University of Helsinki, Helsinki, Finland</p>
            </ins>
            <ins id="I3">
               <p>Departments of Oncology, Helsinki University Central Hospital, Helsinki, Finland</p>
            </ins>
            <ins id="I4">
               <p>Department of Oncology, Uppsala University Hospital, Uppsala, Sweden</p>
            </ins>
         </insg>
         <source>BMC Cancer</source>
         <issn>1471-2407</issn>
         <pubdate>2006</pubdate>
         <volume>6</volume>
         <issue>1</issue>
         <fpage>19</fpage>
         <url>http://www.biomedcentral.com/1471-2407/6/19</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16430786</pubid>
               <pubid idtype="doi">10.1186/1471-2407-6-19</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>09</day>
               <month>9</month>
               <year>2005</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>24</day>
               <month>1</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>24</day>
               <month>1</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Vahteristo et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>BACH1 (BRCA1-associated C-terminal helicase 1; also known as BRCA1-interacting protein 1, BRIP1) is a helicase protein that interacts <it>in vivo </it>with BRCA1, the protein product of one of the major genes for hereditary predisposition to breast cancer. Previously, two <it>BACH1 </it>germ line missense mutations have been identified in early-onset breast cancer patients with and without family history of breast and ovarian cancer.</p>
               <p>In this study, we aimed to evaluate whether there are <it>BACH1 </it>genetic variants that contribute to breast cancer risk in Finland.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>The <it>BACH1 </it>gene was screened for germ line alterations among probands from 43 Finnish <it>BRCA1/2 </it>negative breast cancer families. Recently, one of the observed common variants, Ser-allele of the Ser919Pro polymorphism, was suggested to associate with an increased breast cancer risk, and was here evaluated in an independent, large series of 888 unselected breast cancer patients and in 736 healthy controls.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Six <it>BACH1 </it>germ line alterations were observed in the mutation analysis, but none of these were found to associate with the cancer phenotype. The Val193Ile variant that was seen in only one family was further screened in an independent series of 346 familial breast cancer cases and 183 healthy controls, but no additional carriers were observed. Individuals with the <it>BACH1 </it>Ser919-allele were not found to have an increased breast cancer risk when the Pro/Ser heterozygotes (OR 0.90; 95% CI 0.70&#8211;1.16; p = 0.427) or Ser/Ser homozygotes (OR 1.02; 95% CI 0.76&#8211;1.35; p = 0.91) were compared to Pro/Pro homozygotes, and there was no association of the variant with any breast tumor characteristics, age at cancer diagnosis, family history of cancer, or survival.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our results suggest that the <it>BACH1 </it>Ser919 is not a breast cancer predisposition allele in the Finnish study population. Together with previous studies, our results also indicate that although some rare germ line variants in <it>BACH1 </it>may contribute to breast cancer development, the contribution of <it>BACH1 </it>germline alterations to familial breast cancer seems marginal.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>BACH1 (BRCA1-associated C-terminal helicase 1, also known as BRCA1-interacting protein 1, BRIP1; GenBank: <ext-link ext-link-type="gen" ext-link-id="NM_032043">NM_032043</ext-link>) belongs to a DEAH helicase family and interacts <it>in vivo </it>with BRCA1, the protein product of one of the two major genes for hereditary breast cancer susceptibility <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. Interaction is mediated through BRCT domains of BRCA1, motifs that have been shown to be important for the ability of BRCA1 to mediate double-strand break repair and homologous recombination as well as transcription activation <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. The <it>BACH1 </it>gene is located at chromosome region 17q23. Besides genes known to be involved in the development and progression of breast cancer, such as <it>BRCA1 </it>at 17q21 and <it>ERBB2 </it>at 17q12, the presence of other breast cancer associated genes, both tumor suppressors and oncogenes, have been proposed in the long arm of chromosome 17 on the basis of loss of heterozygosity, allelic imbalance, and comparative genomic hybridization studies <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. The possibility of a tumor suppressor gene located distal to <it>BRCA1 </it>and involved in both sporadic and hereditary ovarian cancer has also been discussed <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>Previously, Cantor and co-workers have reported on <it>BACH1 </it>germ line missense mutations in early-onset breast cancer patients, with one of the patients having a strong family history of both breast and ovarian cancer <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. In subsequent functional analysis both of the observed mutations, Pro47Ala that is located in a highly conserved nucleotide binding domain and Met299Ile that resides in a helicase homology region, were shown to perturb BACH1 protein function by altering both ATPase and helicase activity <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. In addition to these rare mutations in individual families, a common Ser-allele of the Ser919Pro polymorphism has recently been associated with an increased breast cancer risk; in a kin-cohort study a 4.5-fold and up to 6.9-fold increased cumulative breast cancer risk was seen for the first degree relatives of Pro/Ser and Ser/Ser carriers vs. Pro/Pro carriers, respectively, by the age of 50 years <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p>Interestingly, biallelic inactivation of <it>BACH1 </it>was recently observed in patients with Fanconi Anemia (FA), a recessive chromosomal instability disorder characterized by developmental abnormalities, growth retardation, bone marrow failure, and early predisposition to cancer <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. <it>BACH1 </it>mutations were observed in patients with FA complementation group J, whereas similar inactivation of <it>BRCA2 </it>has been previously observed in patients with FA complementation group D1 <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. As individuals with a heterozygous <it>BRCA2 </it>mutation are known to have a markedly elevated risk for developing breast cancer, it's tempting to speculate that a similar effect could also be seen with <it>BACH1</it>. In epidemiological studies an excess of breast cancer cases, although statistically non-significant, have been observed among FA heterozygotes <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. However, this observation needs to be taken cautiously due to the small sample size and lack of analyses of individual complementation groups.</p>
         <p>In this study, we aimed to evaluate whether there are <it>BACH1 </it>genetic variants that contribute to breast cancer risk by screening the <it>BACH1 </it>gene for germ line alterations among 43 Finnish <it>BRCA1/2 </it>negative breast cancer families. We also evaluated the Ser919Pro variant in a large, independent series of 888 unselected breast cancer patients and in 736 healthy controls.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Breast cancer patients and healthy controls</p>
            </st>
            <p>Breast cancer patients belonging to 43 breast cancer families with at least three breast or ovarian cancer cases in 1<sup>st </sup>or 2<sup>nd </sup>degree relatives and with no detectable <it>BRCA1/2 </it>mutations were included in the initial mutation analysis. Recruitment of the families through the Department of Oncology, Helsinki University Central Hospital, Finland as well as verification of the cancer diagnoses and exclusion of the <it>BRCA1 </it>and <it>BRCA2 </it>mutations have been previously described <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>.</p>
            <p>The <it>BACH1 </it>variant Ser919Pro was analyzed in a large series of unselected breast cancer patients and healthy controls. The 888 unselected breast cancer patients were collected at the Helsinki University Central Hospital, Finland, during April 1997-March 1998 <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> and January-June 2000 <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>, and cover 79% of all consecutive, newly diagnosed breast cancer cases during the collection period. DNA samples from altogether 736 healthy females collected at the same geographical region of Southern Finland were studied as healthy population controls. As the variant was associated with an increased breast cancer risk by the age of 50 years <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> the study cohort as well as the population controls were subgrouped according to the menopausal status (age 50 years was chosen as a surrogate for menopause, and patients with cancer diagnosis at &lt; 50 years were considered premenopausal and &#8805;50 years as postmenopausal). Breast tumor characteristics (tumor histology, size, and grade; nodal and distal metastasis; estrogen and progesterone receptor status) were available from all patients. Additionally, a Val193Ile variant that was found in only one family in the initial mutation analysis was further genotyped in randomly selected series of 346 familial breast cancer patients and in 183 healthy population controls. All mutation analyses have been performed on DNA samples extracted from peripheral blood.</p>
            <p>The study was performed with informed consent from the patients and under appropriate research permissions from the Ethics Committees of the Departments of Obstetrics and Gynecology, and Oncology, Helsinki University Central Hospital, Finland, as well as Ministry of Social Affairs and Health in Finland.</p>
         </sec>
         <sec>
            <st>
               <p>Mutation analysis</p>
            </st>
            <p>The coding region and exon-intron boundaries of <it>BACH1 </it>were screened using conformation sensitive gel electrophoresis (CSGE) with modifications previously described <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Samples with aberrant CSGE profiles were reamplified, and the nucleotide changes determined by direct sequencing. Primers and PCR conditions used in the mutation analysis are presented in table <tblr tid="T1">1</tblr>. The frequency of the Ser919Pro alteration was determined by Amplifluor&#8482; fluorescent genotyping (K-Biosciences, Cambridge, UK). The genotyping for nt c.2755 (codon 919) was successful in 866/888 (97.5%) breast cancer patient samples and in 731/736 (99.3%) healthy control samples. The Val193Ile (c.577G>A) variant was genotyped in 346 (successful in 336, 97.1%) familial breast cancer samples and in 183 (successful in 167, 91.3%) control samples, respectively, by Amplifluor&#8482; fluorescent genotyping as well.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primers and PCR conditions used in <it>BACH1 </it>mutation analysis.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Exon</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Strand</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Nucleotide sequence (5'&#8594;3')</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Amplicon lenght (bp)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Annealing temperature (&#176;C)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex2F</p>
                     </c>
                     <c ca="left">
                        <p>CTGTTTCCAGATTTCTCCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex2R</p>
                     </c>
                     <c ca="left">
                        <p>GTGAACCCAGAAAATATTCTCC</p>
                     </c>
                     <c ca="center">
                        <p>331</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex3F</p>
                     </c>
                     <c ca="left">
                        <p>CCCTGGAGTGCAATCTCACT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex3RN</p>
                     </c>
                     <c ca="left">
                        <p>TAGCGACAGCATGGCTGAA</p>
                     </c>
                     <c ca="center">
                        <p>319</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex4F</p>
                     </c>
                     <c ca="left">
                        <p>CCTGGGTGAACTGGGCTGTAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex4RN</p>
                     </c>
                     <c ca="left">
                        <p>TAACAGTAATAATTAAGACTC</p>
                     </c>
                     <c ca="center">
                        <p>316</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex5FN</p>
                     </c>
                     <c ca="left">
                        <p>TTGCCTACCTGTAAGTTATTTATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex5RN</p>
                     </c>
                     <c ca="left">
                        <p>ACCATGTTCAGCTGTAACTAACTG</p>
                     </c>
                     <c ca="center">
                        <p>233</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex6F</p>
                     </c>
                     <c ca="left">
                        <p>GAGCTGTTTTGGCCTTTGAGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex6RN</p>
                     </c>
                     <c ca="left">
                        <p>CTGAGTGGGTTGCTACTGTCCT</p>
                     </c>
                     <c ca="center">
                        <p>317</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex7F</p>
                     </c>
                     <c ca="left">
                        <p>GTTCTGATTCCATGTGAGGTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex7R</p>
                     </c>
                     <c ca="left">
                        <p>GTACATATAAAACACATACTGAGT</p>
                     </c>
                     <c ca="center">
                        <p>448</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex8F</p>
                     </c>
                     <c ca="left">
                        <p>GATGTTCCTCAAATTCTGAGATAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex8R</p>
                     </c>
                     <c ca="left">
                        <p>CATCTAAAAGCTTTTACATTCAAC</p>
                     </c>
                     <c ca="center">
                        <p>386</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex9F</p>
                     </c>
                     <c ca="left">
                        <p>GCCTATAGTGTGAATTTTAAAATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex9R</p>
                     </c>
                     <c ca="left">
                        <p>CCTAGTTAACCAAAGTTTACTAAC</p>
                     </c>
                     <c ca="center">
                        <p>395</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex10F</p>
                     </c>
                     <c ca="left">
                        <p>GATCAACGCATGACAATAATGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex10R</p>
                     </c>
                     <c ca="left">
                        <p>GGGTTACTCACTAGATTTAATCTG</p>
                     </c>
                     <c ca="center">
                        <p>320</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex11F</p>
                     </c>
                     <c ca="left">
                        <p>GCATGTTTTGTTGGGTTTCATTGT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex11R</p>
                     </c>
                     <c ca="left">
                        <p>GGTATGTATTAAACACATGCTAGC</p>
                     </c>
                     <c ca="center">
                        <p>326</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex12F</p>
                     </c>
                     <c ca="left">
                        <p>GTACCAGCTCTTTCAAATGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex12R</p>
                     </c>
                     <c ca="left">
                        <p>CTATCTTTAAAAGAGTCAACCAC</p>
                     </c>
                     <c ca="center">
                        <p>360</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex13FN</p>
                     </c>
                     <c ca="left">
                        <p>GTGCTGGGATTACAGGTGTGAGCCA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex13RN</p>
                     </c>
                     <c ca="left">
                        <p>ACTTGCTGGCACTTCAGGTATCTTC</p>
                     </c>
                     <c ca="center">
                        <p>317</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex14F</p>
                     </c>
                     <c ca="left">
                        <p>CTTGTTGCTTGATCTTTTATGTAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex14R</p>
                     </c>
                     <c ca="left">
                        <p>CTAGGAAGCTTACTGTGGTAA</p>
                     </c>
                     <c ca="center">
                        <p>356</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex15FN</p>
                     </c>
                     <c ca="left">
                        <p>ACAGCTCTATGAGATATATTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex15RN</p>
                     </c>
                     <c ca="left">
                        <p>TCATAGGAGAACAAGTACAAT</p>
                     </c>
                     <c ca="center">
                        <p>504</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex16FN</p>
                     </c>
                     <c ca="left">
                        <p>TTACTTAAAGACATTGAACTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex16RNN</p>
                     </c>
                     <c ca="left">
                        <p>CACTATAAAAGCAAAGCGC</p>
                     </c>
                     <c ca="center">
                        <p>392</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex17FN</p>
                     </c>
                     <c ca="left">
                        <p>CTGTTAGAAGTTAATATGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex17RN</p>
                     </c>
                     <c ca="left">
                        <p>GAATACATACCAGTTCCTATG</p>
                     </c>
                     <c ca="center">
                        <p>325</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex18F</p>
                     </c>
                     <c ca="left">
                        <p>CCAATTTTCTGTCTGTCCCAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex18R</p>
                     </c>
                     <c ca="left">
                        <p>GATAGTAGAGCTCATGTTATGTG</p>
                     </c>
                     <c ca="center">
                        <p>254</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex19F</p>
                     </c>
                     <c ca="left">
                        <p>CTTCACTAGAAAAAGCAAGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex19R</p>
                     </c>
                     <c ca="left">
                        <p>CCACCATATTTAAGGAATTAATC</p>
                     </c>
                     <c ca="center">
                        <p>523</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20A</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex20AFN</p>
                     </c>
                     <c ca="left">
                        <p>ACCTAGCAATTATGTTAGCT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex20ARN</p>
                     </c>
                     <c ca="left">
                        <p>TCTGTATCTTCAGGATCGTA</p>
                     </c>
                     <c ca="center">
                        <p>584</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20B</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Ex20BFN</p>
                     </c>
                     <c ca="left">
                        <p>ATTGATGCCACCCTTACTA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="left">
                        <p>Ex20BRNN</p>
                     </c>
                     <c ca="left">
                        <p>TAACATAAGCATGATGACATA</p>
                     </c>
                     <c ca="center">
                        <p>565</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>Possible associations between the <it>BACH1 </it>Ser919Pro and breast cancer risk, as well as the variant and clinico-pathologic features of the tumors, were tested by univariate analysis. Independent variables were compared with the chi-square test. The mean age at breast cancer diagnoses between the carriers and non-carriers was compared by one-way ANOVA. All p-values were 2-sided, and p-value &lt; 0.01 was considered statistically significant as suggested by Houlston and Peto <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. All statistical analyses were carried out in the SPSS software (version 12.0 for Windows, SPSS, Chicago, IL, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Results and discussion</p>
            </st>
            <p>Altogether six germ line <it>BACH1 </it>variants were observed in the initial mutation analysis (Table <tblr tid="T2">2</tblr>). Four of the changes were in the coding region, two of these were missense and two silent substitutions. The missense changes were analyzed further for their possible association with breast cancer risk. The silent alterations have been suggested as neutral polymorphisms by the previous studies <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>, and were not studied here further. The one missense substitution, Val193Ile, was seen in only one family. In addition to the proband diagnosed with breast cancer at the age of 54 years, the variant was also seen in her healthy father and healthy brother, father's sister diagnosed with skin cancer at age 85 years, and the aunts' three children diagnosed with breast cancer at 63 years, ovarian cancer at 59 years, and skin cancer at 64 years, respectively. The grandmother of the proband, whose carrier status is unknown, has been diagnosed with breast cancer at age 74 years. The variant was not observed among 336 familial breast cancer patients or in 167 healthy population controls. It has previously been observed in 3/200 (1.5%) healthy controls and classified as a rare polymorphism <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The residue resides in close proximity to the ATP/GTP binding site, and the possible functional significance of this rare variant to BACH1 protein function remains to be determined.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Observed germ line variants in <it>BACH1</it>.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Exon/Intron</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Nucleotide change</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Amino acid change</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Frequency for heterozygotes (%)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>int5</p>
                     </c>
                     <c ca="left">
                        <p>508-31 C&#8594;G</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>11/43 (25.6)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ex6</p>
                     </c>
                     <c ca="left">
                        <p>577 G&#8594;A</p>
                     </c>
                     <c ca="left">
                        <p>Val193Ile</p>
                     </c>
                     <c ca="left">
                        <p>1/43 (2.3)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>int14</p>
                     </c>
                     <c ca="left">
                        <p>2097+7 G&#8594;A</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1/43 (2.3)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ex19</p>
                     </c>
                     <c ca="left">
                        <p>2637 G&#8594;A</p>
                     </c>
                     <c ca="left">
                        <p>Glu879Glu</p>
                     </c>
                     <c ca="left">
                        <p>31/43 (72.1)*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ex19</p>
                     </c>
                     <c ca="left">
                        <p>2755 C&#8594;T</p>
                     </c>
                     <c ca="left">
                        <p>Ser919Pro</p>
                     </c>
                     <c ca="left">
                        <p>32/43 (74.4)*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ex20</p>
                     </c>
                     <c ca="left">
                        <p>3411 C&#8594;T</p>
                     </c>
                     <c ca="left">
                        <p>Tyr1137Tyr</p>
                     </c>
                     <c ca="left">
                        <p>27/43 (62.8)*</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* also homozygotes for the rare allele</p>
               </tblfn>
            </tbl>
            <p>The other observed missense substitution, a common polymorphism Ser919Pro, was associated with an elevated breast cancer risk during the course of this study <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. In that study the relative cumulative risk by the age 50 years was 4.5 for the female first degree relatives of Pro/Ser heterozygotes (95% CI 0.8&#8211;12.2; p = 0.096) and up to 6.9 (95% CI 1.6&#8211;29.3; p = 0.018) for the first degree relatives of Ser/Ser homozygotes, when compared to Pro/Pro homozygotes. However, no significant association was seen when the analysis was extended to age 70 years (OR 1.3, 95%CI 0.8&#8211;2.8, p = 0.220) <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Here we found no association of the variant with breast cancer risk. The odds ratios for the whole study cohort as well as for the pre- and postmenopausal patient groups were close to one both for the Pro/Ser heterozygotes and for the Ser/Ser homozygotes when compared to Pro/Pro homozygotes (Table <tblr tid="T3">3</tblr>). The alteration did not associate with breast cancer family history (data not shown). No association of the variant with any of the breast tumor characteristics (Table <tblr tid="T4">4</tblr>) or survival (data not shown) was seen either, and also the age at breast cancer diagnosis was similar in all genotype carrier groups (56.9 years for the Pro/Pro homozygotes, 56.8 years for the heterozygotes, and 56.1 years for the Ser/Ser homozygotes, respectively; p = 0.705). Our data suggest that the <it>BACH1 </it>Ser919Pro alteration is not a breast cancer predisposition allele in our study population although a very low risk effect cannot be excluded. A joint effect on breast cancer risk by the Ser919Pro variant and other epidemiological risk factors may also be possible.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Genotypes of the <it>BACH1 </it>Ser919Pro variant among 866 unselected breast cancer patients and 731 healthy population controls.</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>
                              <ul>Cases</ul>
                           </b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>
                              <ul>Controls</ul>
                           </b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>n</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>%</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>n</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>%</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>OR*</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>95% CI</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>p</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Unselected breast cancer patients, all</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>866</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>731</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Pro</p>
                     </c>
                     <c ca="center">
                        <p>184</p>
                     </c>
                     <c ca="center">
                        <p>21.2</p>
                     </c>
                     <c ca="center">
                        <p>148</p>
                     </c>
                     <c ca="center">
                        <p>20.2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Ser</p>
                     </c>
                     <c ca="center">
                        <p>428</p>
                     </c>
                     <c ca="center">
                        <p>49.4</p>
                     </c>
                     <c ca="center">
                        <p>382</p>
                     </c>
                     <c ca="center">
                        <p>52.3</p>
                     </c>
                     <c ca="center">
                        <p>0.901</p>
                     </c>
                     <c ca="center">
                        <p>0.697&#8211;1.165</p>
                     </c>
                     <c ca="center">
                        <p>0.427</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ser/Ser</p>
                     </c>
                     <c ca="center">
                        <p>254</p>
                     </c>
                     <c ca="center">
                        <p>29.3</p>
                     </c>
                     <c ca="center">
                        <p>201</p>
                     </c>
                     <c ca="center">
                        <p>27.5</p>
                     </c>
                     <c ca="center">
                        <p>1.016</p>
                     </c>
                     <c ca="center">
                        <p>0.765&#8211;1.351</p>
                     </c>
                     <c ca="center">
                        <p>0.911</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Ser + Ser/Ser</p>
                     </c>
                     <c ca="center">
                        <p>682</p>
                     </c>
                     <c ca="center">
                        <p>78.8</p>
                     </c>
                     <c ca="center">
                        <p>583</p>
                     </c>
                     <c ca="center">
                        <p>79.8</p>
                     </c>
                     <c ca="center">
                        <p>0.941</p>
                     </c>
                     <c ca="center">
                        <p>0.738&#8211;1.120</p>
                     </c>
                     <c ca="center">
                        <p>0.623</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Unselected breast cancer patients, diagnosis &lt;50 years</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>276</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>476</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Pro</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                     <c ca="center">
                        <p>20.3</p>
                     </c>
                     <c ca="center">
                        <p>96</p>
                     </c>
                     <c ca="center">
                        <p>20.2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Ser</p>
                     </c>
                     <c ca="center">
                        <p>140</p>
                     </c>
                     <c ca="center">
                        <p>50.7</p>
                     </c>
                     <c ca="center">
                        <p>249</p>
                     </c>
                     <c ca="center">
                        <p>52.3</p>
                     </c>
                     <c ca="center">
                        <p>0.964</p>
                     </c>
                     <c ca="center">
                        <p>0.653&#8211;1.423</p>
                     </c>
                     <c ca="center">
                        <p>0.853</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ser/Ser</p>
                     </c>
                     <c ca="center">
                        <p>80</p>
                     </c>
                     <c ca="center">
                        <p>29</p>
                     </c>
                     <c ca="center">
                        <p>131</p>
                     </c>
                     <c ca="center">
                        <p>27.5</p>
                     </c>
                     <c ca="center">
                        <p>1.047</p>
                     </c>
                     <c ca="center">
                        <p>0.680&#8211;1.611</p>
                     </c>
                     <c ca="center">
                        <p>0.835</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Ser + Ser/Ser</p>
                     </c>
                     <c ca="center">
                        <p>220</p>
                     </c>
                     <c ca="center">
                        <p>79.7</p>
                     </c>
                     <c ca="center">
                        <p>380</p>
                     </c>
                     <c ca="center">
                        <p>79.8</p>
                     </c>
                     <c ca="center">
                        <p>0.993</p>
                     </c>
                     <c ca="center">
                        <p>0.686&#8211;1.436</p>
                     </c>
                     <c ca="center">
                        <p>0.968</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Unselected breast cancer patients, diagnosis &#8805;50 years</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>590</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>255</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Pro</p>
                     </c>
                     <c ca="center">
                        <p>128</p>
                     </c>
                     <c ca="center">
                        <p>21.7</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                     <c ca="center">
                        <p>20.4</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Ser</p>
                     </c>
                     <c ca="center">
                        <p>288</p>
                     </c>
                     <c ca="center">
                        <p>48.8</p>
                     </c>
                     <c ca="center">
                        <p>133</p>
                     </c>
                     <c ca="center">
                        <p>52.2</p>
                     </c>
                     <c ca="center">
                        <p>0.878</p>
                     </c>
                     <c ca="center">
                        <p>0.600&#8211;1.289</p>
                     </c>
                     <c ca="center">
                        <p>0.511</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ser/Ser</p>
                     </c>
                     <c ca="center">
                        <p>174</p>
                     </c>
                     <c ca="center">
                        <p>29.5</p>
                     </c>
                     <c ca="center">
                        <p>70</p>
                     </c>
                     <c ca="center">
                        <p>27.5</p>
                     </c>
                     <c ca="center">
                        <p>1.010</p>
                     </c>
                     <c ca="center">
                        <p>0.660&#8211;1.545</p>
                     </c>
                     <c ca="center">
                        <p>0.964</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro/Ser + Ser/Ser</p>
                     </c>
                     <c ca="center">
                        <p>462</p>
                     </c>
                     <c ca="center">
                        <p>78.3</p>
                     </c>
                     <c ca="center">
                        <p>203</p>
                     </c>
                     <c ca="center">
                        <p>79.6</p>
                     </c>
                     <c ca="center">
                        <p>0.925</p>
                     </c>
                     <c ca="center">
                        <p>0.644&#8211;1.328</p>
                     </c>
                     <c ca="center">
                        <p>0.671</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* as compared to Pro/Pro homozygotes</p>
               </tblfn>
            </tbl>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Tumor characteristics of the 909 breast tumors from 866 breast cancer patientsanalyzed for the <it>BACH1 </it>Ser919Pro variant.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b><it>BACH1 </it>Ser919Pro</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Total n (%)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Pro/Pro</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Pro/Ser</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Ser/Ser</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>p</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Histology</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>909</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Carcinoma ductale</p>
                     </c>
                     <c ca="center">
                        <p>713 (78.4)</p>
                     </c>
                     <c ca="center">
                        <p>145 (76.3)</p>
                     </c>
                     <c ca="center">
                        <p>358 (78.7)</p>
                     </c>
                     <c ca="center">
                        <p>210 (79.5)</p>
                     </c>
                     <c ca="left">
                        <p>0.480</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Carcinoma lobulare</p>
                     </c>
                     <c ca="center">
                        <p>130 (14.3)</p>
                     </c>
                     <c ca="center">
                        <p>25 (13.2)</p>
                     </c>
                     <c ca="center">
                        <p>70 (15.4)</p>
                     </c>
                     <c ca="center">
                        <p>35 (13.3)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Carcinoma medullare</p>
                     </c>
                     <c ca="center">
                        <p>13 (1.4)</p>
                     </c>
                     <c ca="center">
                        <p>5 (2.6)</p>
                     </c>
                     <c ca="center">
                        <p>5 (1.1)</p>
                     </c>
                     <c ca="center">
                        <p>3 (1.1)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Other</p>
                     </c>
                     <c ca="center">
                        <p>53 (5.8)</p>
                     </c>
                     <c ca="center">
                        <p>15 (7.9)</p>
                     </c>
                     <c ca="center">
                        <p>22 (4.8)</p>
                     </c>
                     <c ca="center">
                        <p>16 (6.1)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Tumor grade</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>817</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>223 (27.3)</p>
                     </c>
                     <c ca="center">
                        <p>51 (29.8)</p>
                     </c>
                     <c ca="center">
                        <p>116 (28.2)</p>
                     </c>
                     <c ca="center">
                        <p>56 (23.9)</p>
                     </c>
                     <c ca="left">
                        <p>0.702</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>353 (43.2)</p>
                     </c>
                     <c ca="center">
                        <p>73 (42.7)</p>
                     </c>
                     <c ca="center">
                        <p>174 (42.2)</p>
                     </c>
                     <c ca="center">
                        <p>106 (45.3)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>241 (29.5)</p>
                     </c>
                     <c ca="center">
                        <p>47 (27.5)</p>
                     </c>
                     <c ca="center">
                        <p>122 (29.6)</p>
                     </c>
                     <c ca="center">
                        <p>72 (30.8)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Tumor size, pT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>887</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>545 (61.4)</p>
                     </c>
                     <c ca="center">
                        <p>121 (65.8)</p>
                     </c>
                     <c ca="center">
                        <p>269 (60.7)</p>
                     </c>
                     <c ca="center">
                        <p>155 (59.6)</p>
                     </c>
                     <c ca="left">
                        <p>0.423</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>282 (31.8)</p>
                     </c>
                     <c ca="center">
                        <p>47 (25.5)</p>
                     </c>
                     <c ca="center">
                        <p>148 (33.4)</p>
                     </c>
                     <c ca="center">
                        <p>87 (33.5)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>31 (3.5)</p>
                     </c>
                     <c ca="center">
                        <p>7 (3.8)</p>
                     </c>
                     <c ca="center">
                        <p>15 (3.4)</p>
                     </c>
                     <c ca="center">
                        <p>9 (3.5)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>29 (3.3)</p>
                     </c>
                     <c ca="center">
                        <p>9 (4.9)</p>
                     </c>
                     <c ca="center">
                        <p>11 (2.5)</p>
                     </c>
                     <c ca="center">
                        <p>9 (3.5)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Lymph node status, pN</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>909</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Negative</p>
                     </c>
                     <c ca="center">
                        <p>477 (52.5)</p>
                     </c>
                     <c ca="center">
                        <p>104 (54.7)</p>
                     </c>
                     <c ca="center">
                        <p>223 (49.0)</p>
                     </c>
                     <c ca="center">
                        <p>150 (56.8)</p>
                     </c>
                     <c ca="left">
                        <p>0.101</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Positive</p>
                     </c>
                     <c ca="center">
                        <p>432 (47.5)</p>
                     </c>
                     <c ca="center">
                        <p>86 (45.3)</p>
                     </c>
                     <c ca="center">
                        <p>232 (51.0)</p>
                     </c>
                     <c ca="center">
                        <p>114 (43.2)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Distant Metastasis, pM</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>870</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Negative</p>
                     </c>
                     <c ca="center">
                        <p>829 (95.3)</p>
                     </c>
                     <c ca="center">
                        <p>168 (93.9)</p>
                     </c>
                     <c ca="center">
                        <p>416 (96.1)</p>
                     </c>
                     <c ca="center">
                        <p>245 (95.0)</p>
                     </c>
                     <c ca="left">
                        <p>0.478</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Positive</p>
                     </c>
                     <c ca="center">
                        <p>41 (4.7)</p>
                     </c>
                     <c ca="center">
                        <p>11 (6.1)</p>
                     </c>
                     <c ca="center">
                        <p>17 (3.9)</p>
                     </c>
                     <c ca="center">
                        <p>13 (5.0)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Estrogen receptor status</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>862</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Positive</p>
                     </c>
                     <c ca="center">
                        <p>680 (78.9)</p>
                     </c>
                     <c ca="center">
                        <p>139 (76.8)</p>
                     </c>
                     <c ca="center">
                        <p>339 (78.5)</p>
                     </c>
                     <c ca="center">
                        <p>202 (81.1)</p>
                     </c>
                     <c ca="left">
                        <p>0.530</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Negative</p>
                     </c>
                     <c ca="center">
                        <p>182 (21.1)</p>
                     </c>
                     <c ca="center">
                        <p>42 (23.2)</p>
                     </c>
                     <c ca="center">
                        <p>93 (21.5)</p>
                     </c>
                     <c ca="center">
                        <p>47 (18.9)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Pogesterone receptor status</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>863</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Positive</p>
                     </c>
                     <c ca="center">
                        <p>591 (68.5)</p>
                     </c>
                     <c ca="center">
                        <p>129 (70.9)</p>
                     </c>
                     <c ca="center">
                        <p>289 (66.9)</p>
                     </c>
                     <c ca="center">
                        <p>173 (69.5)</p>
                     </c>
                     <c ca="left">
                        <p>0.577</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Negative</p>
                     </c>
                     <c ca="center">
                        <p>272 (31.5)</p>
                     </c>
                     <c ca="center">
                        <p>53 (29.1)</p>
                     </c>
                     <c ca="center">
                        <p>143 (33.1)</p>
                     </c>
                     <c ca="center">
                        <p>76 (30.5)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Our data, together with previous studies, suggest that germ line mutations in <it>BACH1 </it>do not substantially contribute to the remaining proportion of the familial aggregation of breast cancer outside the high-penetrance genes <it>BRCA1 </it>and <it>BRCA2 </it><abbrgrp><abbr bid="B2">2</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. In the future, it will be interesting to see whether the heterozygous <it>BACH1 </it>mutation carriers in FA families have an excess risk of developing breast or other type of cancer. So far, heterozygous mutations of the FA genes, with the exception of <it>BRCA2</it>, have been found to be extremely rare, or nonexistent, in breast cancer families <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, and the studied polymorphisms have not been found to confer an increased risk for breast cancer [<abbrgrp><abbr bid="B30">30</abbr></abbrgrp>, this study].</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Taken together, our results are in concordance with previous studies where germ line <it>BACH1 </it>mutations have been observed in only a very few familial breast cancer patients <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. This suggests that even though some functionally deleterious germ line <it>BACH1 </it>mutations have been observed in breast cancer patients, such mutations are rare and may account for only a very small proportion, if any, of non-<it>BRCA1/2 </it>familial breast cancer. Our results further indicate that <it>BACH1 </it>Ser919 is not a breast cancer predisposition allele in the Finnish population.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>PV conceived of the study, supervised the molecular genetic studies, performed the statistical analysis and drafted the manuscript. KY and AT carried out the molecular genetic studies. HE and CB collected the patient samples. HN participated in the study design and helped to draft the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We wish to thank Dr. P&#228;ivi Heikkil&#228; for her help with tumor data, and Minna Merikivi and Nina Puolakka for patient contacts. The Finnish Cancer Registry is gratefully acknowledged for cancer data. This study has been financially supported by the Helsinki University Central Hospital Research Fund, Academy of Finland (projects 41486 and 1212901), Finnish Cancer Society, Sigrid Juselius Foundation, Foundation of the Finnish Cancer Institute, and Maud Kuistila Foundation.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1</p>
            </title>
            <aug>
               <au>
                  <snm>Miki</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Swensen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Shattuck-Eidens</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Futreal</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Harshman</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tavtigian</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Cochran</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bennett</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Ding</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Bell</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Rosenthal</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hussey</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tran</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>McClure</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Frye</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hattier</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Phelps</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Haugen-Strano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Katcher</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yakumo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Gholami</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Shaffer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Stone</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bayer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wray</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bogden</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Dayananth</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tonin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Narod</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bristow</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Norris</snm>
                  <fnm>FH</fnm>
               </au>
               <au>
                  <snm>Helvering</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Morrison</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rosteck</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barrett</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Lewis</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Neuhausen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cannon-Albright</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Goldgar</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Wiseman</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kamb</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Skolnick</snm>
                  <fnm>MH</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1994</pubdate>
            <volume>266</volume>
            <fpage>66</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7545954</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function</p>
            </title>
            <aug>
               <au>
                  <snm>Cantor</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Bell</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Ganesan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kass</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Drapkin</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Grossman</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wahrer</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Sgroi</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Lane</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Haber</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Livingston</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2001</pubdate>
            <volume>105</volume>
            <fpage>149</fpage>
            <lpage>160</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(01)00304-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">11301010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The BRCT domain is a phospho-protein binding domain</p>
            </title>
            <aug>
               <au>
                  <snm>Yu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Chini</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mer</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>302</volume>
            <fpage>639</fpage>
            <lpage>642</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1088753</pubid>
                  <pubid idtype="pmpid" link="fulltext">14576433</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Structure of the BRCT repeats of BRCA1 bound to a BACH1 phosphopeptide: implications for signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Shiozaki</snm>
                  <fnm>EN</fnm>
               </au>
               <au>
                  <snm>Gu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Yan</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Shi</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Mol Cell</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <fpage>405</fpage>
            <lpage>412</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1097-2765(04)00238-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">15125843</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Patterns of allelic loss on chromosome 17 in sporadic breast carcinomas detected by fluorescent-labeled microsatellite analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Niederacher</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Picard</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>van Roeyen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>An</snm>
                  <fnm>HX</fnm>
               </au>
               <au>
                  <snm>Bender</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Beckmann</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Genes Chromosomes Cancer</source>
            <pubdate>1997</pubdate>
            <volume>18</volume>
            <fpage>181</fpage>
            <lpage>192</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1098-2264(199703)18:3&lt;181::AID-GCC5>3.0.CO;2-Y</pubid>
                  <pubid idtype="pmpid" link="fulltext">9071571</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Four regions of allelic imbalance on 17q12-qter associated with high-grade breast tumors</p>
            </title>
            <aug>
               <au>
                  <snm>Plummer</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Paris</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Myles</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tubbs</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Crowe</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Casey</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Genes Chromosomes Cancer</source>
            <pubdate>1997</pubdate>
            <volume>20</volume>
            <fpage>354</fpage>
            <lpage>362</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1098-2264(199712)20:4&lt;354::AID-GCC6>3.0.CO;2-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">9408751</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Allelic loss of the BRCA1 and BRCA2 genes and other regions on 17q and 13q in breast cancer among women from Taiwan (area of low incidence but early onset)</p>
            </title>
            <aug>
               <au>
                  <snm>Lo</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Tseng</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>CY</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>1998</pubdate>
            <volume>79</volume>
            <fpage>580</fpage>
            <lpage>587</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1097-0215(19981218)79:6&lt;580::AID-IJC5>3.0.CO;2-M</pubid>
                  <pubid idtype="pmpid" link="fulltext">9842965</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Consortium study on 1280 breast carcinomas: allelic loss on chromosome 17 targets subregions associated with family history and clinical parameters</p>
            </title>
            <aug>
               <au>
                  <snm>Phelan</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Borg</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cuny</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Crichton</snm>
                  <fnm>DN</fnm>
               </au>
               <au>
                  <snm>Baldersson</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Andersen</snm>
                  <fnm>TI</fnm>
               </au>
               <au>
                  <snm>Caligo</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Lidereau</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lindblom</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Seitz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kelsell</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hamann</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Rio</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Thorlacius</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Papp</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Olah</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ponder</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bignon</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Scherneck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Barkardottir</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Borresen-Dale</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Eyfjord</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Theillet</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Devilee</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Larsson</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1998</pubdate>
            <volume>58</volume>
            <fpage>1004</fpage>
            <lpage>1012</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9500463</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Genomic and expression profiling of chromosome 17 in breast cancer reveals complex patterns of alterations and novel candidate genes</p>
            </title>
            <aug>
               <au>
                  <snm>Orsetti</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Nugoli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cervera</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lasorsa</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Chuchana</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ursule</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Redon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>du Manoir</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rodriguez</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Theillet</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>64</volume>
            <fpage>6453</fpage>
            <lpage>6460</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-04-0756</pubid>
                  <pubid idtype="pmpid" link="fulltext">15374954</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>A deletion unit on chromosome 17q in epithelial ovarian tumors distal to the familial breast/ovarian cancer locus</p>
            </title>
            <aug>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>IJ</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Wiseman</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Futreal</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Harrington</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Osborne</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Leech</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Molyneux</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Berchuck</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ponder</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1993</pubdate>
            <volume>53</volume>
            <fpage>1218</fpage>
            <lpage>1221</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8095178</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>A common region of deletion on chromosome 17q in both sporadic and familial epithelial ovarian tumors distal to BRCA1</p>
            </title>
            <aug>
               <au>
                  <snm>Godwin</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Vanderveer</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Schultz</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>HT</fnm>
               </au>
               <au>
                  <snm>Altomare</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Buetow</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Getts</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Masny</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rosenblum</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hogan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ozols</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Hamilton</snm>
                  <fnm>TC</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1994</pubdate>
            <volume>55</volume>
            <fpage>666</fpage>
            <lpage>677</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7942844</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Isolation and mapping of a human septin gene to a region on chromosome 17q, commonly deleted in sporadic epithelial ovarian tumors</p>
            </title>
            <aug>
               <au>
                  <snm>Russell</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>McIlhatton</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Burrows</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Donaghy</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Chanduloy</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Petty</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Kalikin</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Church</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>McIlroy</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Harkin</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Keilty</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Cranston</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Weissenbach</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hickey</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Johnston</snm>
                  <fnm>PG</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2000</pubdate>
            <volume>60</volume>
            <fpage>4729</fpage>
            <lpage>4734</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10987277</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Cantor</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Drapkin</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Pamidi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Livingston</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <fpage>2357</fpage>
            <lpage>2362</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">356955</pubid>
                  <pubid idtype="pmpid" link="fulltext">14983014</pubid>
                  <pubid idtype="doi">10.1073/pnas.0308717101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Kin-cohort estimates for familial breast cancer risk in relation to variants in DNA base excision repair, BRCA1 interacting and growth factor genes</p>
            </title>
            <aug>
               <au>
                  <snm>Sigurdson</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Hauptmann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Chatterjee</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Alexander</snm>
                  <fnm>BH</fnm>
               </au>
               <au>
                  <snm>Doody</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Rutter</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Struewing</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>BMC Cancer</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>9</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">408462</pubid>
                  <pubid idtype="pmpid" link="fulltext">15113441</pubid>
                  <pubid idtype="doi">10.1186/1471-2407-4-9</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J</p>
            </title>
            <aug>
               <au>
                  <snm>Levitus</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Waisfisz</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Godthelp</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Vries</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hussain</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wiegant</snm>
                  <fnm>WW</fnm>
               </au>
               <au>
                  <snm>Elghalbzouri-Maghrani</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Steltenpool</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rooimans</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Pals</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Arwert</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Mathew</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Zdzienicka</snm>
                  <fnm>MZ</fnm>
               </au>
               <au>
                  <snm>Hiom</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>De Winter</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Joenje</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <fpage>934</fpage>
            <lpage>935</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng1625</pubid>
                  <pubid idtype="pmpid" link="fulltext">16116423</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia</p>
            </title>
            <aug>
               <au>
                  <snm>Levran</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Attwooll</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Henry</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Milton</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Neveling</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Rio</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Batish</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Kalb</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Velleuer</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Barral</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Petrini</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schindler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hanenberg</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Auerbach</snm>
                  <fnm>AD</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <fpage>931</fpage>
            <lpage>933</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng1624</pubid>
                  <pubid idtype="pmpid" link="fulltext">16116424</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Biallelic inactivation of BRCA2 in Fanconi anemia</p>
            </title>
            <aug>
               <au>
                  <snm>Howlett</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Taniguchi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cox</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Waisfisz</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>De Die-Smulders</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Persky</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Grompe</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Joenje</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Pals</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ikeda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Fox</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>D'Andrea</snm>
                  <fnm>AD</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2002</pubdate>
            <volume>297</volume>
            <fpage>606</fpage>
            <lpage>609</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1073834</pubid>
                  <pubid idtype="pmpid" link="fulltext">12065746</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Reassessment of cancer predisposition of Fanconi anemia heterozygotes</p>
            </title>
            <aug>
               <au>
                  <snm>Swift</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Caldwell</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Chase</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>1980</pubdate>
            <volume>65</volume>
            <fpage>863</fpage>
            <lpage>867</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6933255</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Familial breast cancer in southern Finland: how prevalent are breast cancer families and can we trust the family history reported by patients?</p>
            </title>
            <aug>
               <au>
                  <snm>Eerola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Blomqvist</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pukkala</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Pyrhonen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Eur J Cancer</source>
            <pubdate>2000</pubdate>
            <volume>36</volume>
            <fpage>1143</fpage>
            <lpage>1148</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0959-8049(00)00093-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">10854948</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Low proportion of BRCA1 and BRCA2 mutations in Finnish breast cancer families: evidence for additional susceptibility genes</p>
            </title>
            <aug>
               <au>
                  <snm>Vehmanen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Friedman</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Eerola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>McClure</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Sarantaus</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kainu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Syrjakoski</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pyrhonen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kallioniemi</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>Muhonen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Luce</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Frank</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>1997</pubdate>
            <volume>6</volume>
            <fpage>2309</fpage>
            <lpage>2315</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/6.13.2309</pubid>
                  <pubid idtype="pmpid" link="fulltext">9361038</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>A probability model for predicting BRCA1 and BRCA2 mutations in breast and breast-ovarian cancer families</p>
            </title>
            <aug>
               <au>
                  <snm>Vahteristo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Eerola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tamminen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Blomqvist</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Br J Cancer</source>
            <pubdate>2001</pubdate>
            <volume>84</volume>
            <fpage>704</fpage>
            <lpage>708</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1054/bjoc.2000.1626</pubid>
                  <pubid idtype="pmpid" link="fulltext">11237395</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Population-based study of BRCA1 and BRCA2 mutations in 1035 unselected Finnish breast cancer patients</p>
            </title>
            <aug>
               <au>
                  <snm>Syrjakoski</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Vahteristo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Eerola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tamminen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kivinummi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sarantaus</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Holli</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Blomqvist</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kallioniemi</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>Kainu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>2000</pubdate>
            <volume>92</volume>
            <fpage>1529</fpage>
            <lpage>1531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jnci/92.18.1529</pubid>
                  <pubid idtype="pmpid" link="fulltext">10995809</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Correlation of CHEK2 protein expression and c.1100delC mutation status with tumor characteristics among unselected breast cancer patients</p>
            </title>
            <aug>
               <au>
                  <snm>Kilpivaara</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Bartkova</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Eerola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Syrjakoski</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Vahteristo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Lukas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Blomqvist</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Holli</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Heikkila</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sauter</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kallioniemi</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>Bartek</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>2005</pubdate>
            <volume>113</volume>
            <fpage>575</fpage>
            <lpage>580</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ijc.20638</pubid>
                  <pubid idtype="pmpid" link="fulltext">15472904</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>p53, Chk2, and Chk1 genes in finnish families with li-fraumeni syndrome: further evidence of chk2 in inherited cancer predisposition</p>
            </title>
            <aug>
               <au>
                  <snm>Vahteristo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tamminen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Karvinen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Eerola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Eklund</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Aaltonen</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Blomqvist</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Aittomaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2001</pubdate>
            <volume>61</volume>
            <fpage>5718</fpage>
            <lpage>5722</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11479205</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>The future of association studies of common cancers</p>
            </title>
            <aug>
               <au>
                  <snm>Houlston</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Peto</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2003</pubdate>
            <volume>112</volume>
            <fpage>434</fpage>
            <lpage>435</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12574941</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>No mutations in the BACH1 gene in BRCA1 and BRCA2 negative breast-cancer families linked to 17q22</p>
            </title>
            <aug>
               <au>
                  <snm>Luo</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lei</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Du</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>von Wachenfeldt</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kockum</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Luthman</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Vorechovsky</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lindblom</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>2002</pubdate>
            <volume>98</volume>
            <fpage>638</fpage>
            <lpage>639</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ijc.10214</pubid>
                  <pubid idtype="pmpid" link="fulltext">11920628</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>No evidence of involvement of germline BACH1 mutations in Finnish breast and ovarian cancer families</p>
            </title>
            <aug>
               <au>
                  <snm>Karppinen</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Vuosku</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Heikkinen</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Allinen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Winqvist</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Eur J Cancer</source>
            <pubdate>2003</pubdate>
            <volume>39</volume>
            <fpage>366</fpage>
            <lpage>371</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0959-8049(02)00498-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">12565990</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Mutational analysis of the BRCA1-interacting genes ZNF350/ZBRK1 and BRIP1/BACH1 among BRCA1 and BRCA2-negative probands from breast-ovarian cancer families and among early-onset breast cancer cases and reference individuals</p>
            </title>
            <aug>
               <au>
                  <snm>Rutter</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Davila</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Sigurdson</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Giusti</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Pineda</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Doody</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Tucker</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Struewing</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2003</pubdate>
            <volume>22</volume>
            <fpage>121</fpage>
            <lpage>128</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.10238</pubid>
                  <pubid idtype="pmpid" link="fulltext">12872252</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Evaluation of Fanconi Anemia genes in familial breast cancer predisposition</p>
            </title>
            <aug>
               <au>
                  <snm>Seal</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Barfoot</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Jayatilake</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Renwick</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bascombe</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>McGuffog</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Evans</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Eccles</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Easton</snm>
                  <fnm>DF</fnm>
               </au>
               <au>
                  <snm>Stratton</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Rahman</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2003</pubdate>
            <volume>63</volume>
            <fpage>8596</fpage>
            <lpage>8599</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">14695169</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Dragovic</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Stephenson</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Eccles</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>IG</fnm>
               </au>
               <au>
                  <snm>Dobrovic</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>BMC Cancer</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>43</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1112586</pubid>
                  <pubid idtype="pmpid" link="fulltext">15860134</pubid>
                  <pubid idtype="doi">10.1186/1471-2407-5-43</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2407/6/19/prepub</url>
         </p>
      </sec>
   </bm>
</art>
