The human leukemia cell lines CCRF-CEM (T-ALL) and REH (Bp-ALL t(12;21)) were obtained from the American Type Culture Collection. NALM6 (Bp-ALL) cell line was obtained from DSMZ (Germany). RCH-ACV (Bp- ALL t(1;19)) was kindly provided by Dr. Stephen Hunger (UFL, Gainesville, FL). All cell lines were grown in RPMI 1640 (Sigma) supplemented with 10% FBS at 37°C and 5% CO₂. Normal bone marrow (BM) was extracted from normal volunteers. We obtained institutional review board approval, and IRB approved informed consent was obtained from normal volunteers prior to participation.

Total RNA was isolated using the RNeasy kit (Qiagen Inc). FPGS exons 14 and 15 were RT-PCR amplified 15 and quantitated using pFPGS-cDNA, a pCR2.1-TOPO plasmid containing the human FPGS cDNA gene (1926 bp; Table 1). Briefly, the 1926 pb FPGS cDNA gene was amplified by PCR using primers 1exonF and 15exonR-c1934 (Table 1) from total RNA reverse transcribed with primer 15exonR-c2107 (5'-GGCCAGGCAGCGCACACAAT). Results were normalized to β-actin mRNA expression. All real-time PCR reactions (SYBR green) were performed using the BIO-RAD iCycler iQ system (Bio-Rad) 18.

Nuclear run-on assay was performed as described by Hanson et al. 19. One μg of FPGS and 18S RNA cDNAs were blotted, UV cross-linked and hybridized with nascent labeled RNA transcripts. After washing, membranes were exposed to XAR-5 film (Kodak). Densitometric scan analysis was performed using the GelPro Analyzer program. Results were normalized to the level of 18S RNA and statistic achieved using one-tailed, Student paired t-test (GraphPad Prism, version 2.01). All data are expressed as mean ± S.E.M.

Amplification of the 5'-termini of FPGS mRNA was performed using the 5'-RACE system Version 2.0 (Invitrogen Corporation). Briefly, polyA+ RNA isolated from cells using the Oligotex Direct mRNA mini kit (Qiagen) were reverse transcribed using the oligonucleotide Exon5R-F8 (5'-CTTGGTGAAGAGCTCAGGACTG), a gene-specific primer in exon 5. The poly dC-tailed cDNA products were amplified using a nested primer in exon 2, Exon2R-F4 (5'- ACTCCGTGCCAGGTACAGTTCCATG), and the abridged anchor primer. Primary PCR products were re-amplified using an exon 2 upstream nested primer, 2exonR-2381 (5'-CAGGTAGCCGGCATTGGTCTG), and the abridged universal amplification primer. 5'-RACE products were separated on a 2.5% agarose gel, purified and cloned into the pCR2.1-TOPO vector (Invitrogen). Identity of the 5'-RACE products was determined by nucleotide sequence.

Regions of the FPGS gene promoter were generated by PCR, cloned into pCR2.1-TOPO vector and sub-cloned into pGL3-basic vector (Promega) or pGL2628-ATGm/c. Plasmids and primers used in this study are listed in Table 1. The BAC clone RCPI-11 465E22 contains 188,098 bp of human chromosome 9 including 104,600 bp upstream of FPGS exon 1 (obtained from Dr. P.J. de Jong, Children's Hospital Oakland). PCR conditions were optimized for each of these fragments.

The CCRF-CEM, NALM6 and REH cell lines were transfected by nucleofection (Amaxa Biosystems) following manufacturer's protocol. Briefly, 5 × 10⁶ cells were resuspended in 100 μl of solution V^® (CCRF-CEM and NALM6) or R^® (REH) and mixed with 2.5 μg of plasmid pGL1374 (FPGS promoter::luc) or equimolar concentration of other FPGS promoter::luc plasmids, and 3 μg of pCMVβ. Cells were incubated at 37°C/5% CO₂ for 24 hrs, harvested, washed twice with cold PBS 1X and resuspended in dual-light lysis buffer to yield cellular extracts. Luciferase and β-galactosidase activities were assayed using the dual-light reporter gene assay system (Tropix, Inc.). Transfection efficiencies and cell viability were monitored by flow cytometry. Cell viability was 70–75% and 78–85% for CCRF-CEM and NALM6 cells, respectively. Statistical tests were achieved using one-tailed, Student paired t-test (GraphPad Prism, version 2.01).

Genomic DNA was isolated from CCRF-CEM and NALM6 cells using the DNeasy kit (Qiagen, Inc.) and treated with sodium bisulfite to convert unmethylated cytosine to uracil residues while 5-methylcytosines remain unaltered (CpGenome DNA modification kit [Chemicon International]). Identification of CpG islands and design primer sets were determined using the MethPrimer program [33]. Chemically converted genomic DNA was PCR amplified using specific primer sets for methylated and unmethylated forms (Table 1). Methyl-specific PCR (MSP) products were resolved on a 3% agarose gel.

The QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate substitution mutants of the human FPGS mitochondrial and cytosolic initiation codons (ATG) from the pGL2628 plasmid using oligonucleotides QC19934F/QC19934R and QC20060F/QC20060R, respectively (Table 1). Similarly, FPGS putative NFY868 and E-box952 binding sites were mutagenized using the plasmid pGL2628-ATGm/c plasmid DNA template. Primers NFY-868F/NFY-868R and E47-952F/E47-952R were used for the NFY and E-box mutagenesis, respectively (Table 1). Mutations were confirmed by nucleotide sequencing.

Nuclear extracts were prepared from CCRF-CEM and NALM6 cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce, Biotechnology, Inc.). DNA-protein interactions were carried out and detected using the LightShift Chemiluminescent EMSA kit (Pierce, Biotechnology, Inc.). Each EMSA reactions contained 25 nM labeled FPGS -32/-14 (5'-CTGCGCTGATTGGCTGGGG) oligonucleotides, 50 ng Poly (dI-dC) and 10 μg of nuclear protein. When required, competitive unlabeled NFY DNA oligomer, unlabeled Epstein-Barr nuclear antigen (EBNA) DNA, and NFY antibody (CBF-A (C20) or CBF-B (H209) (Santa Cruz, Biotechnology, Inc.)) were added to EMSA. The DNA-protein complexes were resolved on non-denaturing 5% TBE polyacrylamide gels (Bio-Rad).

To investigate whether differences in FPGS mRNA expression in Bp-ALL and T-ALL resulted from differences in FPGS promoter transcription rate, we determined the frequency of transcription initiation in CCRF-CEM and NALM6 cells using nuclear run-on assays. As shown in Figure 1A, ratio of FPGS/18S mRNA transcription rate was 1.64-fold higher in NALM6 (2.26 ± 0.768) vs. CCRF-CEM (1.37 ± 0.416) cells (p < 0.05). These results are consistent with the observed two- to three-fold higher levels of FPGS mRNA, protein expression and activity in NALM6 vs. CCRF-CEM 91115.

To uncover potential regulatory regions involved in the lineage differences in expression of the FPGS gene, we localized the FPGS promoter in Bp-ALL vs. T-ALL cell lines by mapping FPGS transcription initiation sites using 5'-RACE. These experiments detected a long (~280 bp) and a short (~180 bp) fragment, which were individually characterized by nucleotide sequence analysis to encode mitochondrial/cytosolic and cytosolic FPGS, respectively. Long fragments were detected in CCRF-CEM (T-ALL) whereas both short and long fragments were amplified from NALM6 and REH (Bp-ALL) (Figure 1B). Therefore, both Bp-ALL and T-ALL cells use the same promoter to transcribe FPGS mRNA but lineage differences in mRNA transcripts exist.

The human FPGS minimal promoter has been characterized in CCRF-CEM cells and encompassed a region starting -43 bp from the main transcriptional start site to +150 bp of exon 1 17 (see Figure 2). To further investigate the mechanisms that control FPGS transcription in human hematopoietic cells, we analyzed and compared DNA fragments located upstream of exon A1b and in the 5'-flanking region of exon 1 (encompassing the previously described minimal promoter region) for promoter/enhancer transcriptional activity in CCRF-CEM and NALM6 cells. FPGS-luciferase transcriptional gene fusions were constructed and assayed as described in Material and Methods. Under our experimental conditions, transfection efficiencies were 38–50% and 42–50% in CCRF-CEM and NALM6 cells, respectively. As shown in Figure 3, DNA fragments located upstream of exon A1b (pGL2256 and pGL3588-2628) yielded no promoter or enhancer activity in both cell lines suggesting that the 5'-flanking region of exon A1b exerts no regulatory activity on human FPGS expression. The higher level of luciferase activity detected in pGL3588-2628 vs. pGL2256 is likely the result of the presence of the additional fragment of 2628 bp contained in pGL3588-2628 that included the FPGS minimal promoter region. When DNA fragments from the 5'-flanking region of exon 1 (pGL1374, pGL2628-ATGm/c, pGL4689) encompassing the described minimal promoter were analyzed, we found 4- to 12-fold higher level of luciferase/β-galactosidase activity in CCRF-CEM compared to NALM6 cells (Figure 3). To validate our reporter gene assay and rule out any technical differences in luciferase activity in NALM6 vs. CCRF-CEM cells, we assayed a CMV promoter-luciferase driven vector (pCMV-luc) and found no significant differences in both cell lines (data not shown). Therefore, these data indicate that DNA fragments containing the previously described minimal promoter region are not sufficient to effectively drive FPGS transcription in Bp-ALL (NALM6) compared to T-ALL (CCRF-CEM). Similar experiments with other Bp-ALL cell lines such as RCH-ACV (t(1:19)) and REH (t(12;21)) were performed and yielded same results (data not shown). To exclude that differences in nucleotide sequence were responsible for low promoter activity observed in Bp-ALL, we PCR amplified and sequenced the 1374 bp fragment containing the minimal promoter from normal bone marrow (BM), CCRF-CEM and NALM6 cells. No difference in nucleotide sequence was detected.

The inability of the minimal promoter region to efficiently drive FPGS transcription in NALM6 cells implied that additional unidentified regulatory regions may be required in Bp-ALL cells. To test this hypothesis we then investigated the presence of enhancers or transcription factors required for FPGS transcription in NALM6 vs. CCRF-CEM cells, by analyzing the effect in cis of DNA fragments located within the exons A1b-1 and in the 3'-UTR of the FPGS gene on the FPGS-luc expression of pGL2628-ATGm/c. As shown in Figure 3, plasmids pGL2299-2628, pGL2158-2628, pGL1163-2628, and pGL2881-2628 constructs yielded 1.8- to 4.2-fold lower level of luciferase activity in NALM6 vs. CCRF-CEM cells. Therefore, the regulatory elements required for FPGS gene expression in Bp-ALL appear not to be localized within a region encompassing 12 kb upstream of exon 1 nor within the 3'-untranslated region.

DNA methylation has been associated with transcriptional inactivation and gene silencing 2021. Nucleotide sequence analysis of the 1374 bp fragment (-791 to +582) containing the FPGS minimal promoter predicted one CpG island (54% GC content) at position -330 to +294. We determined whether DNA methylation could contribute to the lineage-specific differences in FPGS expression in ALL cell lines by methylation-specific PCR (MSP) analysis using bisulfite-treated DNA. Primers sets were designed to anneal to unmethylated DNA (U) and methylated templates (M). As shown in Figure 4A, amplification products (142 bp) were detected in both CCRF-CEM and NALM6 bisulfite-treated nuclear DNA with unmethylated primers (U) indicating a preferentially unmethylated CpG island in both cell lines. Control experiments with untreated DNA or absence of template yielded no products (data not shown). Quantitative analysis of cytosine methylation was determined in both cell lines by sequencing of the 142 bp unmethylated PCR amplicon. This analysis revealed identical number of unmethylated cytosines in both cell lines. Therefore, DNA methylation of the CpG island region which contains the described FPGS minimal promoter does not play a role in the observed lineage-specific differences in FPGS expression in ALL cell lines.

To identify specific regulatory elements involved in FPGS gene transcription, we analyzed the nucleotide sequence of the minimal FPGS gene promoter for presence of known transcription factor recognition motifs using the MatInspector program (Genomatix, release 7.3.1). As shown in Figure 2, two Sp1 (GGGCGG; -10, -15), one reverse Sp1 (+5), one inverted NFY-box (CCAAT; -20), and one E-box (CANNTG; +61) transcription factor binding sites were identified within the FPGS minimal promoter (minP). We examined the role of putative NFY and E-box DNA binding sites by generating mutants at each site with substitutions reported to reduce or abolish gene promoter activity 2223. Mutant constructs for NFY (NFY-868; CCAAT → CTTTT) and E-box (Ebox-952; CACCTG → CATTCG) were co-transfected with pCMVβ in both CCRF-CEM and NALM6 cells and assayed for luciferase and β-galactosidase activities. As shown in Figure 4B, mutation in the NFY site (NFY-868) reduced the level of FPGS transcription by 45% in NALM6 (p < 0.001) and 40% in CCRF-CEM cells (p < 0.005) when compared to the wild type construct (pGL2628-ATGm/c). Normalized luciferase activities were 1.9 × 10^-2 ± 2.0 × 10^-3 (pGL2628-ATGm/c) and 1.0 × 10^-2 ± 1.2 × 10^-3 (pGL868NFY-ATGm/c) in NALM6, and 2.4 × 10^-1 ± 2.4 × 10^-2 (pGL2628-ATGm/c) and 1.5 × 10^-1 ± 1.4 × 10^-2 (pGL868NFY-ATGm/c) in CCRF-CEM cells. These data suggest that the NFY binding site is required to activate FPGS gene transcription in lymphoid cells. In contrast, no significant differences were observed in either cell line with the mutant Ebox-952 construct, suggesting a negligible role in FPGS expression (Figure 4B). In NALM6 and CCRF-CEM cells, the normalized level of luciferase activity was 1.6 × 10^-2 ± 8.4 × 10^-4 (pGL952Ebox-ATGm/c) and 2.2 × 10^-1 ± 1.8 × 10^-2 (pGL952Ebox-ATGm/c), respectively.

To establish NFY protein interaction with the NFY-box element (CCAAT) at position -20 upstream the FPGS gene promoter, we performed electrophoretic mobility shift assays (EMSAs) using an oligonucleotide probe containing FPGS gene sequence from -32 to -14. The sequences of double-stranded biotinylated oligonucleotide probes and competitors were incubated with nuclear extracts prepared from CCRF-CEM or NALM6 cells. The EMSA revealed the formation of two complexes with the NFY oligonucleotide probe (Figure 4C, C1 and C2). To further ascertain the specificity of binding, we demonstrated that the formation of complexes C1 and C2 were inhibited by excess amounts of unlabeled NFY oligonucleotides (Figure 4C, lanes 3 and 8) but not with unlabeled non-specific Epstein-Barr nuclear antigen (EBNA) oligonucleotides (Figure 4C, lane 6). To directly evaluate the proposed participation of NFY in the shifted complexes, anti-NFY peptide (CBF-A and CBF-B subunits) antibodies were incubated with EMSA binding reactions before electrophoresis. Addition of anti NFY-A (CBF-A) antibody to these reactions resulted in strongly retarded supershift complex (SSC) (Figure 4C, lanes 4 and 9). In contrast, addition of NFY-B (CBF-B) antibody abolished the formation of the complex C2 (Figure 4C, lanes 5 and 10) without formation of a supershifted band. These data clearly demonstrate that NFY transcription factor is present in the complex that binds to the putative NFY binding site (CCAAT) at position -20.