<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2350-8-38</ui>
   <ji>1471-2350</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Mutations in the 3'-untranslated region of <it>GATA4 </it>as molecular hotspots for congenital heart disease (CHD)</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Reamon-Buettner</snm>
               <mnm>Marie</mnm>
               <fnm>Stella</fnm>
               <insr iid="I1"/>
               <email>reamon-buettner@item.fraunhofer.de</email>
            </au>
            <au id="A2">
               <snm>Cho</snm>
               <fnm>Si-Hyen</fnm>
               <insr iid="I1"/>
               <email>borlak@item.fraunhofer.de</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Borlak</snm>
               <fnm>Juergen</fnm>
               <insr iid="I1"/>
               <email>borlak@item.fraunhofer.de</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Drug Research and Medical Biotechnology, Fraunhofer Institute of Toxicology and Experimental Medicine, Nikolai-Fuchs-Strasse 1, D-30625 Hannover, Germany</p>
            </ins>
         </insg>
         <source>BMC Medical Genetics</source>
         <issn>1471-2350</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>38</fpage>
         <url>http://www.biomedcentral.com/1471-2350/8/38</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17592645</pubid>
               <pubid idtype="doi">10.1186/1471-2350-8-38</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>16</day>
               <month>11</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>25</day>
               <month>6</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>25</day>
               <month>6</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Reamon-Buettner et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The 3'-untranslated region (3'-UTR) of mRNA contains regulatory elements that are essential for the appropriate expression of many genes. These regulatory elements are involved in the control of nuclear transport, polyadenylation status, subcellular targetting as well as rates of translation and degradation of mRNA. Indeed, 3'-UTR mutations have been associated with disease, but frequently this region is not analyzed. To gain insights into congenital heart disease (CHD), we have been analyzing cardiac-specific transcription factor genes, including <it>GATA4</it>, which encodes a zinc finger transcription factor. Germline mutations in the coding region of <it>GATA4 </it>have been associated with septation defects of the human heart, but mutations are rather rare. Previously, we identified 19 somatically-derived zinc finger mutations in diseased tissues of malformed hearts. We now continued our search in the 609 bp 3'-UTR region of <it>GATA4 </it>to explore further molecular avenues leading to CHD.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>By direct sequencing, we analyzed the 3'-UTR of <it>GATA4 </it>in DNA isolated from 68 formalin-fixed explanted hearts with complex cardiac malformations encompassing ventricular, atrial, and atrioventricular septal defects. We also analyzed blood samples of 12 patients with CHD and 100 unrelated healthy individuals.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We identified germline and somatic mutations in the 3'-UTR of <it>GATA4</it>. In the malformed hearts, we found nine frequently occurring sequence alterations and six dbSNPs in the 3'-UTR region of <it>GATA4</it>. Seven of these mutations are predicted to affect RNA folding. We also found further five nonsynonymous mutations in exons 6 and 7 of <it>GATA4</it>. Except for the dbSNPs, analysis of tissue distal to the septation defect failed to detect sequence variations in the same donor, thus suggesting somatic origin and mosaicism of mutations. In a family, we observed c.+119A > T in the 3'-UTR associated with ASD type II.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our results suggest that somatic <it>GATA4 </it>mutations in the 3'-UTR may provide an additional molecular rationale for CHD.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>GATA4 (MIM# 600576) is a transcription factor which is characterized by a highly conserved binding domain of two zinc fingers. It is expressed in the heart and is essential for mammalian cardiac development (see reviews <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>). In mice, germline ablation of the gene encoding Gata4 results in abnormal ventral folding of the embryo, failure to form a single ventral tube, and lethality <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. Besides heart development, Gata4 is involved in the formation of multiple organs, such as intestine, liver, pancreas and swim bladder in zebrafish <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> as well as gastric epithelial development in mouse through interaction with Fog co-factors <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
         <p>In humans, four <it>GATA4 </it>gene mutations have been identified in families with congenital heart defects (CHD) notably, atrial septal defects <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. One mutation (p.Gly296Ser) affects a highly conserved amino acid after the C-terminal zinc finger, and disrupts physical interaction with TBX5 <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, a transcription factor described to be defective in Holt-Oram syndrome <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. But <it>GATA4 </it>germline mutations are rather rare. Two studies analyzed 16 families each, but only 2/16 families with multiple affected members carried <it>GATA4 </it>mutations <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. In 42 patients with non-syndromic atrioventricular septal defects (familial as well as sporadic), no <it>GATA4 </it>mutations have been detected <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>.</p>
         <p>It is of considerable importance that genetic analysis of blood samples may not reveal somatically-occurring sequence alterations in the diseased cardiac tissues, but these mutations may provide a molecular rationale for pathogenesis <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. We recently reported evidence for somatically-derived <it>NKX2-5 </it>and <it>TBX5 </it>mutations as a novel mechanism for septation defects of the human heart <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>, and used the same heart collection of malformed hearts to investigate <it>GATA4 </it>gene mutations, notably those affecting the coding of amino acids for zinc finger functions of the protein <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. To identify further genetic alterations associated with CHD, we continued our search in the 609 bp of 3'-untranslated region (3'-UTR) of <it>GATA4</it>.</p>
         <p>The 3'-UTR of <it>GATA4 </it>is relatively long and likely contains regulatory elements essential for the regulation and transport of the mRNA transcript <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Indeed, evidence is accumulating that the 3'-UTR of mRNA is involved in the control of nuclear transport, polyadenylation status, subcellular targetting as well as rates of translation and degradation of mRNA; thus sequence alterations in this region may lead to disease (see review <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp>). Recently, a single nucleotide deletion in the 3'-UTR of high mobility group A1 gene (<it>HMGA1) </it>was identified in two type 2 diabetes patients exhibiting deficiency of the protein <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. The mutation decreased <it>HMGA1 </it>mRNA half life in the lymphoblast cells of the patients, and further deletion of the 3'-UTR of <it>HMGA1 </it>resulted in the decrease of reporter assay expression. To the best of our knowledge, the 3'-UTR of <it>GATA4 </it>has not been investigated particularly as regards its role in post-transcriptional gene expression. In this paper, we report the detection of frequent <it>GATA4 </it>sequence alterations in the 3'-UTR in the diseased tissues of malformed hearts, some of which are predicted to alter RNA secondary structure. As a result of aberrant RNA folding, these mutations may lead to CHD by affecting mRNA localization and translation of protein. We found further five nonsynonymous mutations in exons 6 and 7 of <it>GATA4</it>.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p><it>GATA4 </it>is located on chromosome 8p23.1-p22, consists of seven exons and codes for a 442- amino-acid protein (see Fig. <figr fid="F1">1A</figr>). We investigated the genomic DNA for sequence variations in the entire coding region and untranslated regions (UTR) of this gene. In the case of formalin-fixed material, exons 3, 4, 6 and 7 of malformed hearts of patients with complex CHD could be amplified. We reported earlier the detection of 23 nonsynonymous mutations in exons 3 and 4, notably mutations affecting the zinc fingers of GATA4 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Here we report further five nonsynonymous mutations in exons 6 and 7, which affect highly conserved amino acids 361, 377, 430, 432 and 442 in the C-terminal region of GATA4 (Table <tblr tid="T2">2</tblr>). Whether these sequence alterations result in aberrant protein expression requires additional studies. Previously, it has been shown that a frameshift mutation past amino acid 359 severely altered the encoded GATA4 protein and was associated with ASD <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Nonetheless, mutations p.Leu432Ser and p.Ala442Thr identified by us would affect polarity of the protein, due to replacement of non-polar, hydrophophic amino acids with polar, hydrophilic ones. In addition, p.Met361Val likely results in aberrant RNA folding, as determined by a method described below.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Genetic analysis of <it>GATA4</it></p>
            </caption>
            <text>
               <p>Genetic analysis of <it>GATA4</it>. <b>(A) </b>Schematic representation of GATA4 (genomic, mRNA and protein level). Reference sequence for <it>GATA4 </it>was based on NM_002052 and the intron-exon boundaries on [42]. <b>(B) </b>Examples of 3'-UTR mutations and genotypes obtained after direct sequencing of fragments amplified from diseased cardiac tissues of patients affected by CHD. Additional sequence alterations in the 3'- UTR of <it>GATA4 </it>were detected, e.g. F24ASD (c.+281G>A).</p>
            </text>
            <graphic file="1471-2350-8-38-1"/>
         </fig>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Summary of <it>GATA4 </it>sequence variations in diseased cardiac tissues of patients with CHD</p>
            </caption>
            <tblbdy cols="9">
               <r>
                  <c ca="left">
                     <p>Nucleotide change NM_002052</p>
                  </c>
                  <c ca="left">
                     <p>Coding region</p>
                  </c>
                  <c ca="left">
                     <p>Amino acid change</p>
                  </c>
                  <c ca="left">
                     <p>Location</p>
                  </c>
                  <c ca="center">
                     <p>Positive hearts (n = 29 VSD)</p>
                  </c>
                  <c ca="center">
                     <p>Positive hearts (n = 16 ASD)</p>
                  </c>
                  <c ca="center">
                     <p>Positive hearts (n= 23 AVSD)</p>
                  </c>
                  <c ca="center">
                     <p>Total</p>
                  </c>
                  <c ca="center">
                     <p>PCR-RFLP assay</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>NONSYNONYMOUS**</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1599</p>
                  </c>
                  <c ca="left">
                     <p>c.1081A>G</p>
                  </c>
                  <c ca="left">
                     <p>p.Met361Val</p>
                  </c>
                  <c ca="left">
                     <p>exon 6</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1648</p>
                  </c>
                  <c ca="left">
                     <p>c.1130G>A</p>
                  </c>
                  <c ca="left">
                     <p>p.Ser377Asn</p>
                  </c>
                  <c ca="left">
                     <p>exon 6</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1806</p>
                  </c>
                  <c ca="left">
                     <p>c.1288C>G</p>
                  </c>
                  <c ca="left">
                     <p>p.Leu430Val</p>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1813</p>
                  </c>
                  <c ca="left">
                     <p>c.1295T>C</p>
                  </c>
                  <c ca="left">
                     <p>p.Leu432Ser</p>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1842</p>
                  </c>
                  <c ca="left">
                     <p>c.1324G>A</p>
                  </c>
                  <c ca="left">
                     <p>p.Ala442Thr</p>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>3'UNTRANSLATED REGION</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1857</p>
                  </c>
                  <c ca="left">
                     <p>c.+10T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p><it>Earl</it>I</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1891</p>
                  </c>
                  <c ca="left">
                     <p>c.+44T>A</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1924</p>
                  </c>
                  <c ca="left">
                     <p>c.+77C>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>2*</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>3*</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p><it>Sty</it>l</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2065</p>
                  </c>
                  <c ca="left">
                     <p>c.+218C>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p><it>Earl</it>I</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2106</p>
                  </c>
                  <c ca="left">
                     <p>c.+259A>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>2*</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2127</p>
                  </c>
                  <c ca="left">
                     <p>c.+280T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>3*</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2289</p>
                  </c>
                  <c ca="left">
                     <p>c.+442A>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2309</p>
                  </c>
                  <c ca="left">
                     <p>c.+462T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2326</p>
                  </c>
                  <c ca="left">
                     <p>c.+479A>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1*</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p><it>Nar</it>I</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2201</p>
                  </c>
                  <c ca="left">
                     <p>c.+354A>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7, dbSNPrs867858</p>
                  </c>
                  <c ca="center">
                     <p>27AA:2AC</p>
                  </c>
                  <c ca="center">
                     <p>12AA:4AC</p>
                  </c>
                  <c ca="center">
                     <p>19AA:3AC:1CC</p>
                  </c>
                  <c ca="center">
                     <p>58AA:9AC:1CC</p>
                  </c>
                  <c ca="center">
                     <p><it>Msp</it>A1I</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2273</p>
                  </c>
                  <c ca="left">
                     <p>c.+426C>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7, dbSNPrs1062219</p>
                  </c>
                  <c ca="center">
                     <p>1CC:8CT:20TT</p>
                  </c>
                  <c ca="center">
                     <p>2CT: 13TT</p>
                  </c>
                  <c ca="center">
                     <p>1CC: 4CT:18TT</p>
                  </c>
                  <c ca="center">
                     <p>2CC:14CT:51TT</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2364</p>
                  </c>
                  <c ca="left">
                     <p>c.+517T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7, dbSNPrs884662</p>
                  </c>
                  <c ca="center">
                     <p>9TT:16CT:4CC</p>
                  </c>
                  <c ca="center">
                     <p>4TT:11CT</p>
                  </c>
                  <c ca="center">
                     <p>4TT:15CT:4CC</p>
                  </c>
                  <c ca="center">
                     <p>17TT:42CT:8CC</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2379</p>
                  </c>
                  <c ca="left">
                     <p>c.+532T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7, dbSNPrs904018</p>
                  </c>
                  <c ca="center">
                     <p>1TT:9CT:19CC</p>
                  </c>
                  <c ca="center">
                     <p>9CT:6CC</p>
                  </c>
                  <c ca="center">
                     <p>1TT:3CT:19CC</p>
                  </c>
                  <c ca="center">
                     <p>2TT:21CT:44CC</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2410</p>
                  </c>
                  <c ca="left">
                     <p>c.+563C>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7, dbSNPrs12825</p>
                  </c>
                  <c ca="center">
                     <p>15CC:8CG:6GG</p>
                  </c>
                  <c ca="center">
                     <p>2CC:12CG</p>
                  </c>
                  <c ca="center">
                     <p>15CC:6CG:2GG</p>
                  </c>
                  <c ca="center">
                     <p>32CC:26CG:8GG</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2434</p>
                  </c>
                  <c ca="left">
                     <p>c.+587A>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>exon 7, dbSNPrs804291</p>
                  </c>
                  <c ca="center">
                     <p>1AG:28GG</p>
                  </c>
                  <c ca="center">
                     <p>13GG</p>
                  </c>
                  <c ca="center">
                     <p>23GG</p>
                  </c>
                  <c ca="center">
                     <p>1AG:64GG</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>* homozygous genotypes observed</p>
               <p>** nonsynonymous mutations in exons 3 and 4 reported earlier (Reamon-Buettner and Borlak, J Med Genet 42:e32)</p>
            </tblfn>
         </tbl>
         <p>Notably, exon 7 of <it>GATA4 </it>consists of 1,708 bp, the majority (1,525 bp) being untranslated. From our collection of formalin-fixed hearts, we could amplify the first four fragments of exon 7 (see Fig. <figr fid="F1">1A</figr> and Table <tblr tid="T1">1</tblr> for the primer sequences designated GTx7-1 to GTx7-4). These primer sequences cover a part of the coding region c.1221 to c.1329 (nt 1739&#8211;1847, NM_002052) and 3'-UTR from c.+1 to c.+609 (nt 1848&#8211;2456, NM_002052). We found 9 sequence alterations, occurring in 3 to 7 patients, and 6 dbSNPs in the analyzed 3'-UTR region of <it>GATA4 </it>(Table <tblr tid="T2">2</tblr>, Table <tblr tid="T3">3</tblr>). On the basis of sequence electropherograms and/or PCR-RFLP assays, both heterozygous and homozygous genotypes were observed (Fig. <figr fid="F1">1B</figr>). Using the program GeneQuest (Lasergene 6.0), we determined the effect of the nine sequence alterations on RNA folding. GeneQuest uses the Vienna RNA folding procedure, taken from Zuker's optimal RNA folding algorithm, to fold the sense strand of selected DNA regions as RNA. We investigated the first 500 bp of the 3'-UTR, simply because the sequence alterations identified by us are located within this segment. Furthermore, there is suggestion that the whole 3-'UTR is not necessary for localization, but that localization signals lie within the regions of &lt; 100&#8211;200 nt <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Compared to the reference sequence, 7/9 of these would result in faulty RNA folding (Fig. <figr fid="F2">2</figr>). While c.+77C > T and c.+479A > G would likely not lead to faulty RNA folding, the same pattern was observed for c.+10T > C and c.+44T > A. In addition, we searched the 3'-UTR of <it>GATA4 </it>for highly conserved motifs that may be involved in post-transcriptional regulation, (see <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>). None of the conserved motifs reported so far have been detected, but the highly conserved motif (AATAAA) associated with polyadenylation signals were located at positions c.+678&#8211;683 and c.+1502&#8211;1507.</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Primer sequences and PCR conditions used for analysis of <it>GATA4 </it>mutations</p>
            </caption>
            <tblbdy cols="7">
               <r>
                  <c ca="center">
                     <p><it>GATA4 </it>exons</p>
                  </c>
                  <c ca="center">
                     <p>Exon size (bp)</p>
                  </c>
                  <c ca="left">
                     <p>Primer</p>
                  </c>
                  <c ca="center">
                     <p>Primer length</p>
                  </c>
                  <c ca="left">
                     <p>Primer sequence (5'-3')</p>
                  </c>
                  <c ca="center">
                     <p>Melting temperature</p>
                  </c>
                  <c ca="center">
                     <p>PCR product length (bp)</p>
                  </c>
               </r>
               <r>
                  <c cspan="7">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 1</p>
                  </c>
                  <c ca="center">
                     <p>61</p>
                  </c>
                  <c ca="left">
                     <p>GT4x1F</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>cttgcacgtgactcccacag</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>250</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x1R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>aagcaaaggcggagaagctc</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 2</p>
                  </c>
                  <c ca="center">
                     <p>1073</p>
                  </c>
                  <c ca="left">
                     <p>GT4x2-1F</p>
                  </c>
                  <c ca="center">
                     <p>21</p>
                  </c>
                  <c ca="left">
                     <p>tctctttctgtcgttcctctt</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>600</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x2-1R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gcacgtagactggcgaggac</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x2-2F</p>
                  </c>
                  <c ca="center">
                     <p>21</p>
                  </c>
                  <c ca="left">
                     <p>ggaccatgtatcagagcttgg</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>641</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x2-2R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gccctcgcgctcctactcac</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 3</p>
                  </c>
                  <c ca="center">
                     <p>167</p>
                  </c>
                  <c ca="left">
                     <p>GT4x3F</p>
                  </c>
                  <c ca="center">
                     <p>24</p>
                  </c>
                  <c ca="left">
                     <p>agtcagagtgaggaagagcaagag</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>541</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x3R</p>
                  </c>
                  <c ca="center">
                     <p>21</p>
                  </c>
                  <c ca="left">
                     <p>cagtttctgtgtgccgaagag</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 4</p>
                  </c>
                  <c ca="center">
                     <p>126</p>
                  </c>
                  <c ca="left">
                     <p>GT4x4F</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>ccagccctgcctcccgttag</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>294</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x4R</p>
                  </c>
                  <c ca="center">
                     <p>23</p>
                  </c>
                  <c ca="left">
                     <p>gaggactgagagatgggcatcag</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 5</p>
                  </c>
                  <c ca="center">
                     <p>88</p>
                  </c>
                  <c ca="left">
                     <p>GT4x5F</p>
                  </c>
                  <c ca="center">
                     <p>22</p>
                  </c>
                  <c ca="left">
                     <p>agtagccatcacatcacacagg</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>504</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x5R</p>
                  </c>
                  <c ca="center">
                     <p>19</p>
                  </c>
                  <c ca="left">
                     <p>aaagctcccaacacgttcc</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 6</p>
                  </c>
                  <c ca="center">
                     <p>149</p>
                  </c>
                  <c ca="left">
                     <p>GT4x6F</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gtttgtccctgccgctgatt</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>247</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x6R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gcagtcggcctccccacaaa</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1708</p>
                  </c>
                  <c ca="left">
                     <p>GTx7-1F</p>
                  </c>
                  <c ca="center">
                     <p>19</p>
                  </c>
                  <c ca="left">
                     <p>acaaggctatgcgtctccc</p>
                  </c>
                  <c ca="center">
                     <p>60&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>289</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-1R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>ctgagaaaatccaacacccg</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x7-2F</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gcgtaatcttccctcttccc</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>291</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GT4x7-2R</p>
                  </c>
                  <c ca="center">
                     <p>19</p>
                  </c>
                  <c ca="left">
                     <p>gggacaaggacatcttggg</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-3F</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gtcgacaatctggttagggg</p>
                  </c>
                  <c ca="center">
                     <p>60&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>281</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-3R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gtacatggcaaacagatgcc</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-4F</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>gaggatctgagaacaagcgg</p>
                  </c>
                  <c ca="center">
                     <p>60&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>270</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-4R</p>
                  </c>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>cagctgcattttgatgaggc</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-5F</p>
                  </c>
                  <c ca="center">
                     <p>22</p>
                  </c>
                  <c ca="left">
                     <p>aaattgtggggtgtgacataca</p>
                  </c>
                  <c ca="center">
                     <p>60 &#176;C</p>
                  </c>
                  <c ca="center">
                     <p>577</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-5R</p>
                  </c>
                  <c ca="center">
                     <p>22</p>
                  </c>
                  <c ca="left">
                     <p>gttgcagaatctctggcttttt</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-6F</p>
                  </c>
                  <c ca="center">
                     <p>22</p>
                  </c>
                  <c ca="left">
                     <p>ctgtctgtctgctcctcctagc</p>
                  </c>
                  <c ca="center">
                     <p>65&#176;C</p>
                  </c>
                  <c ca="center">
                     <p>586</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>GTx7-6R</p>
                  </c>
                  <c ca="center">
                     <p>22</p>
                  </c>
                  <c ca="left">
                     <p>acctcccagtgaagaccactaa</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Spectrum of <it>GATA4 </it>mutations (nonsynonymous and 3'-UTR) in diseased tissues of malformed hearts</p>
            </caption>
            <tblbdy cols="6">
               <r>
                  <c ca="left">
                     <p>Patient</p>
                  </c>
                  <c ca="left">
                     <p>Age</p>
                  </c>
                  <c ca="center">
                     <p>Total defects*</p>
                  </c>
                  <c ca="center">
                     <p>Detected mutations</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>Coding (ns)***</p>
                  </c>
                  <c ca="center">
                     <p>3'-UTR</p>
                  </c>
                  <c ca="center">
                     <p>Total</p>
                  </c>
               </r>
               <r>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>VSDs</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C06VSD**</p>
                  </c>
                  <c ca="left">
                     <p>1h</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>F211L, Y244C, R260Q, C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C10VSD</p>
                  </c>
                  <c ca="left">
                     <p>stillborn</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C19VSD</p>
                  </c>
                  <c ca="left">
                     <p>3 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C58VSD</p>
                  </c>
                  <c ca="left">
                     <p>18 d</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+77C>T</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>D01VSD</p>
                  </c>
                  <c ca="left">
                     <p>aborted</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>D03VSD</p>
                  </c>
                  <c ca="left">
                     <p>2 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E03VSD**</p>
                  </c>
                  <c ca="left">
                     <p>6 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+77C>T</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E04VSD**</p>
                  </c>
                  <c ca="left">
                     <p>5 wk</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E08VSD</p>
                  </c>
                  <c ca="left">
                     <p>53 yr</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E10VSD</p>
                  </c>
                  <c ca="left">
                     <p>6 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>G214S</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E11VSD</p>
                  </c>
                  <c ca="left">
                     <p>newborn</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E13VSD</p>
                  </c>
                  <c ca="left">
                     <p>16 yr</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>N239S, C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E15VSD</p>
                  </c>
                  <c ca="left">
                     <p>8 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>N239D</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E16VSD</p>
                  </c>
                  <c ca="left">
                     <p>3 mo</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>M361V</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E20VSD</p>
                  </c>
                  <c ca="left">
                     <p>2 d</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E22VSD</p>
                  </c>
                  <c ca="left">
                     <p>4 mo</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>F208L, C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E23VSD**</p>
                  </c>
                  <c ca="left">
                     <p>22 d</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>L261P, C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E26VSD</p>
                  </c>
                  <c ca="left">
                     <p>6 mo</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>C292R, <b>S377N</b></p>
                  </c>
                  <c ca="center">
                     <p>c.+479A>G</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E27VSD</p>
                  </c>
                  <c ca="left">
                     <p>5 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>M223T, R229S, C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+462T>C</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E28VSD</p>
                  </c>
                  <c ca="left">
                     <p>5 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+44T>A</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E29VSD</p>
                  </c>
                  <c ca="left">
                     <p>8 wk</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E31VSD</p>
                  </c>
                  <c ca="left">
                     <p>5 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E33VSD</p>
                  </c>
                  <c ca="left">
                     <p>14 yr</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>A442T</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E34VSD</p>
                  </c>
                  <c ca="left">
                     <p>3 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E35VSD</p>
                  </c>
                  <c ca="left">
                     <p>4.5 mo</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E39VSD</p>
                  </c>
                  <c ca="left">
                     <p>9 mo</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+218C>T, c.+259A>G</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E40VSD</p>
                  </c>
                  <c ca="left">
                     <p>15 mo</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E41VSD</p>
                  </c>
                  <c ca="left">
                     <p>23 yr</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+280T>C</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E49VSD</p>
                  </c>
                  <c ca="left">
                     <p>newborn</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+442A>G</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>ASDs</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C09ASD</p>
                  </c>
                  <c ca="left">
                     <p>26 yr</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C39ASD</p>
                  </c>
                  <c ca="left">
                     <p>25 yr</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C45ASD</p>
                  </c>
                  <c ca="left">
                     <p>6 d</p>
                  </c>
                  <c ca="center">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p>C292R, <b>L432S</b></p>
                  </c>
                  <c ca="center">
                     <p>c.+280T>C, c.+462T>C</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C46ASD</p>
                  </c>
                  <c ca="left">
                     <p>34 yr</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C, c.+259A>G, c.+462T>C</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C64ASD</p>
                  </c>
                  <c ca="left">
                     <p>11 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C75ASD</p>
                  </c>
                  <c ca="left">
                     <p>2 mo</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>D30ASD</p>
                  </c>
                  <c ca="left">
                     <p>11 yr</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>L430V</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>D33ASD</p>
                  </c>
                  <c ca="left">
                     <p>8 yr</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>N248S, L261P</p>
                  </c>
                  <c ca="center">
                     <p>c.+462T>C, c.+479A>G</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F17ASD</p>
                  </c>
                  <c ca="left">
                     <p>4 1/2 h</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+280T>C</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F19ASD</p>
                  </c>
                  <c ca="left">
                     <p>8 yr</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+462T>C</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F20ASD</p>
                  </c>
                  <c ca="left">
                     <p>10 yr</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F24ASD</p>
                  </c>
                  <c ca="left">
                     <p>6 yr</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+280T>C</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>27ASD</p>
                  </c>
                  <c ca="left">
                     <p>7 yr</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+442A>G</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F29ASD</p>
                  </c>
                  <c ca="left">
                     <p>14 yr</p>
                  </c>
                  <c ca="center">
                     <p>8</p>
                  </c>
                  <c ca="center">
                     <p>I255T, A294V</p>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F30ASD</p>
                  </c>
                  <c ca="left">
                     <p>1 d</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F32ASD</p>
                  </c>
                  <c ca="left">
                     <p>38 yr</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>R229S</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>AVSDs</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C43AVSD</p>
                  </c>
                  <c ca="left">
                     <p>10 mo</p>
                  </c>
                  <c ca="center">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p>H302R</p>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C70/2AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>8 mo</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>G234S, R252P, C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C71AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>4 d</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C, c.+442A>G</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E05AVSD</p>
                  </c>
                  <c ca="left">
                     <p>16 wk</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E36AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>3.5 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>E43AVSD</p>
                  </c>
                  <c ca="left">
                     <p>4.5 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>R283H</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F00AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>6 wk</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+44T>A, c.+218C>T</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F02AVSD</p>
                  </c>
                  <c ca="left">
                     <p>10 mo</p>
                  </c>
                  <c ca="center">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p>N248S</p>
                  </c>
                  <c ca="center">
                     <p>c.+77C>T</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F03AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>1 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+44T>A</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F04AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>11 wk</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+218C>T, c.+259A>G</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F05AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>10 wk</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>F211L, R229S, Y244C, N285K</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F08AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>5 mo</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>P226fs</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F11AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>7 mo</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+77C>T</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F12AVSD</p>
                  </c>
                  <c ca="left">
                     <p>6 mo</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>R266X</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F13AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>25 mo</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F14AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>1 mo</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>T277I, C292R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F14aAVSD**</p>
                  </c>
                  <c ca="left">
                     <p>5 wk</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+462T>C</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F15AVSD</p>
                  </c>
                  <c ca="left">
                     <p>5 d</p>
                  </c>
                  <c ca="center">
                     <p>7</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+218C>T, c.+259A>G</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F18AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>7 mo</p>
                  </c>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F28AVSD</p>
                  </c>
                  <c ca="left">
                     <p>8 yr</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>N273S, <b>L430V</b></p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F31AVSD**</p>
                  </c>
                  <c ca="left">
                     <p>8 d</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+479A>G</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F38AVSD</p>
                  </c>
                  <c ca="left">
                     <p>3 mo</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>C292R</p>
                  </c>
                  <c ca="center">
                     <p>c.+10T>C, c.+77C>T, c.+280T>C</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>F40AVSD</p>
                  </c>
                  <c ca="left">
                     <p>10 mo</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>c.+44T>A</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>* Heart malformations described earlier in Reamon-Buettner et al. 2004 Am J Pathol 2004, 164:2117&#8211;2125.</p>
               <p>** Down syndrome</p>
               <p>*** nonsynonymous <it>GATA4 </it>mutations in exons 3 and 4 reported earlier in Reamon-Buettner and Borlak 2005, J Med Genet 42:e32; new mutations detected in exons 6 and 7 are in bold</p>
            </tblfn>
         </tbl>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Effect of mutations in the 3'-UTR of <it>GATA4 </it>on mRNA folding</p>
            </caption>
            <text>
               <p>Effect of mutations in the 3'-UTR of <it>GATA4 </it>on mRNA folding. Using the program GeneQuest (Lasergene 6.0), the effect of sequence alterations on RNA folding was predicted using the first c.+500 nt in the 3'-UTR of <it>GATA4</it>. GeneQuest uses the Vienna RNA folding procedure, taken from Zuker's optimal RNA folding algorithm [43], to fold the sense strand of selected DNA regions as RNA. Compared to the reference sequence, 7/9 mutations would result in faulty RNA folding, on which five patterns here are shown. Same pattern was observed for c.+10 T > C and c.+44T > A.</p>
            </text>
            <graphic file="1471-2350-8-38-2"/>
         </fig>
         <p>To compare healthy vs. diseased tissues from each patient, we selected specifically those who were positive for mutations in the diseased tissue. For instance, in the diseased tissues, we found 17/68 patients without nucleotide changes in analyzed region of the 3'-UTR except for the dbSNPs. Thus for this comparison, we analyzed 21 patients for GTx7-1 (21 &#215; 2 &#215; 289 bp = 12,138 nucleotides); 25 patients for GTx7-3 (25 &#215; 2 &#215; 281 bp = 14,050 nucleotides) and 24 patients for GTx7-4 (24 &#215; 2 &#215; 270 bp = 12,960 nucleotides). Except for the dbSNPs rs867858, rs1062219, rs884662, rs904018, rs12825 (see Table <tblr tid="T2">2</tblr>), none of the mutations were detected in the unaffected tissues. This result suggests somatic origin and mosaicism of mutations.</p>
         <p>In the formalin-fixed malformed hearts, we observed six dbSNPs which were all located within 234 nucleotides in exon 7 (Table <tblr tid="T2">2</tblr>). We could calculate the allele frequencies for five loci (Table <tblr tid="T2">2</tblr>) and found the dbSNPs to be in Hardy-Weinberg equilibrium. We cloned three fragments from hearts heterozygous for rs1062219 (c.+426C > T), rs884662 (c.+517T > C) and rs904018 (c.+532T > C). Surprisingly, we found three haplotypes after sequencing of at least four clones in each heart. In all three hearts, we found one type containing all reference alleles [c.+426C; c.+517T; c.+532T] and another type with all variant alleles [c.+426T; c.+517C; c.+532C]. Additional types found were [c.+426T; c.+517T; c.+532T] with one variant allele, and [c.+426C; c.+517C; c.+532C] with two variant alleles.</p>
         <p>We further analyzed the entire gene in blood samples of 12 patients with CHD (see Fig. <figr fid="F1">1A</figr>). Mostly dbSNPs were detected (Table <tblr tid="T4">4</tblr>); nonetheless we observed two sequence variations in the 3'-UTR (c.+119A > T and c.+1260G > A) and two intronic (c.-518-25C > T and c.-458+5A > G) which have not yet been reported as dbSNPs. The 3'-UTR alterations and c.-518-25C>T were detected in a family of four, in which the two children were affected by ASD, but the parents had no history of CHD. For c.+119A>T, the mother was homozygous for the reference allele AA, while the father and the children had the heterozygous genotype AT (Fig. <figr fid="F3">3A&amp;B</figr>). This sequence variation would affect RNA folding (Fig. <figr fid="F3">3C</figr>). As control, we analyzed blood samples from 100 unrelated Caucasian healthy individuals. No sequence variations were found, except for a synonymous change in exon 3 (c.699G>A, p.233Thr), an intronic (c.783+16G>A) and dbSNPs (Table <tblr tid="T4">4</tblr>).</p>
         <tbl id="T4">
            <title>
               <p>Table 4</p>
            </title>
            <caption>
               <p>Summary of <it>GATA4 </it>sequence variations in blood samples</p>
            </caption>
            <tblbdy cols="7">
               <r>
                  <c ca="left">
                     <p>Nucleotide change NM_002052</p>
                  </c>
                  <c ca="left">
                     <p>Coding region</p>
                  </c>
                  <c ca="left">
                     <p>Amino acid change</p>
                  </c>
                  <c ca="center">
                     <p>Location</p>
                  </c>
                  <c ca="left">
                     <p>NCBI dbSNP number</p>
                  </c>
                  <c ca="center">
                     <p>Blood samples CHD</p>
                  </c>
                  <c ca="center">
                     <p>Blood samples normal</p>
                  </c>
               </r>
               <r>
                  <c cspan="7">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>NONSYNONYMOUS</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1647</p>
                  </c>
                  <c ca="left">
                     <p>c.1129A>G</p>
                  </c>
                  <c ca="left">
                     <p>p.Ser377Gly</p>
                  </c>
                  <c ca="center">
                     <p>exon 6</p>
                  </c>
                  <c ca="left">
                     <p>rs3729856</p>
                  </c>
                  <c ca="center">
                     <p>10AA:2AG</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>SYNONYMOUS</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1217</p>
                  </c>
                  <c ca="left">
                     <p>c.699G>A</p>
                  </c>
                  <c ca="left">
                     <p>p.Thr233</p>
                  </c>
                  <c ca="center">
                     <p>exon 3</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1 (GA)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>3'-UTR</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1967</p>
                  </c>
                  <c ca="left">
                     <p>c.+119A>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2 (AT)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3107</p>
                  </c>
                  <c ca="left">
                     <p>c.+1260G>A</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1 (GA)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2201</p>
                  </c>
                  <c ca="left">
                     <p>c.+354A>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs867858</p>
                  </c>
                  <c ca="center">
                     <p>3AA:9AC</p>
                  </c>
                  <c ca="center">
                     <p>53AA:36AC:11CC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2273</p>
                  </c>
                  <c ca="left">
                     <p>c.+426C>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs1062219</p>
                  </c>
                  <c ca="center">
                     <p>1CC:8CT:3TT</p>
                  </c>
                  <c ca="center">
                     <p>39CC:38CT:23TT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2364</p>
                  </c>
                  <c ca="left">
                     <p>c.+517T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs884662</p>
                  </c>
                  <c ca="center">
                     <p>4TT:5CT:3CC</p>
                  </c>
                  <c ca="center">
                     <p>43TT:30CT:27CC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2379</p>
                  </c>
                  <c ca="left">
                     <p>c.+532T>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs904018</p>
                  </c>
                  <c ca="center">
                     <p>1TT:5CT: 6CC</p>
                  </c>
                  <c ca="center">
                     <p>30TT: 30CT:40CC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2410</p>
                  </c>
                  <c ca="left">
                     <p>c.+563C>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs12825</p>
                  </c>
                  <c ca="center">
                     <p>8CC:3CG:1GG</p>
                  </c>
                  <c ca="center">
                     <p>69CC:11CG:20GG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2434</p>
                  </c>
                  <c ca="left">
                     <p>c.+587A>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs804291</p>
                  </c>
                  <c ca="center">
                     <p>12GG</p>
                  </c>
                  <c ca="center">
                     <p>100 GG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3005</p>
                  </c>
                  <c ca="left">
                     <p>c.+1158C>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs11785481</p>
                  </c>
                  <c ca="center">
                     <p>7CC:5CT</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3103</p>
                  </c>
                  <c ca="left">
                     <p>c.+1256A>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs12458</p>
                  </c>
                  <c ca="center">
                     <p>3AA:9AT</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3202</p>
                  </c>
                  <c ca="left">
                     <p>c.+1355G>A</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs1062270</p>
                  </c>
                  <c ca="center">
                     <p>11GG:1AG</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3368</p>
                  </c>
                  <c ca="left">
                     <p>c.+1521G>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="left">
                     <p>rs3293358</p>
                  </c>
                  <c ca="center">
                     <p>5CC:6CG:1GG</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <b>INTRONIC</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>c.-518-25C>T</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>intron</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>2 (1CT:1TT)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>c.-458+5A>G</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>intron</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1 (AG)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>c.783+16G>A</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>intron</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>1 (GA)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>c.614-61G>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>intron</p>
                  </c>
                  <c ca="left">
                     <p>rs10503425</p>
                  </c>
                  <c ca="center">
                     <p>8GG:3CG:1CC</p>
                  </c>
                  <c ca="center">
                     <p>27AA:12AC:3CC</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>c.997+56A>C</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>intron</p>
                  </c>
                  <c ca="left">
                     <p>rs804280</p>
                  </c>
                  <c ca="center">
                     <p>3AA:7AC:2CC</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>Detection of 3'-UTR mutations in blood samples of patients with CHD</p>
            </caption>
            <text>
               <p>Detection of 3'-UTR mutations in blood samples of patients with CHD. (A) sequence electropherograms for c.+119A>T, showing heterozygous (AT) and homozygous (AA) genotypes; (B) in a family of four in which the two children had ASD; the father and the children had the heterozygous genotype AT (+), the mother was homozygous for the reference allele AA; (C) Compared to the reference sequence and on the basis of Vienna RNA folding procedure, c.+119A>T is predicted to affect RNA folding.</p>
            </text>
            <graphic file="1471-2350-8-38-3"/>
         </fig>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Recent studies characterize further the importance of Gata4 in cardiac development. Indeed, small changes in the level of Gata4 protein expression can dramatically influence cardiac morphogenesis and embryonic survival <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Moreover, myocardial expression of <it>Gata4 </it>is required for proliferation of cardiomyocytes, formation of the endocardial cushions, development of the right ventricle, and septation of the outflow tract <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. To gain further insights into the role of <it>GATA4 </it>mutations in CHD in humans, we have analyzed the Leipzig collection of malformed hearts for sequence alterations of this gene. We reported previously the identification of 23 nonsynonymous mutations, 19 of which are located within the highly conserved zinc fingers and basic regions of GATA4 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Notably, we identified a frequent mutation (p.Cys292Arg) in VSDs, which affects one of the four zinc coordinating cysteines in the C-finger and is predicted to disrupt the secondary structure of the protein. Functional characterization of site-directed mutated residues in the C-finger, showed that disruption of the zinc coordinating cysteines, would abolish DNA binding, Gata4-Nkx2-5 interactions and synergy <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>.</p>
         <p>To identify genetic alterations associated with CHD, we continued our search for mutations in the 3'-UTR region of <it>GATA4</it>. In the diseased tissues of malformed hearts, we found frequent alterations in the 3'-UTR of <it>GATA4</it>, in which 7/9 would affect RNA folding. Additional sequence alterations in the 3'- UTR of <it>GATA4 </it>were detected, but these were mostly isolated cases and therefore not reported here. Further, we identified a germline mutation (c.+119A>T) in which two affected family members were positive. Similarly, it would alter RNA folding. Since the unaffected father carried c.+119A>T, we cannot discount the possibilities of a low penetrance mutation or no causal association at all. Whether the 3'-UTR mutations reported here contributed to cardiac malformations by affecting the secondary structure of mRNA or through other post-transcriptional regulation associated with 3'-UTR, requires further functional analysis. Nonetheless, it has been shown that two mutations in the 3'-UTR of rat <it>Mti </it>(metallothionein-1) that are predicted to alter the secondary structure of this region also impaired localization of the mRNA <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
         <p>There is, however, accumulating evidence on the important role of 3'-UTR in post-transcriptional regulation. For instance, efficient termination and stability of mRNA are dependent on a properly configured 3'-UTR <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Localization of mRNAs is also due to specific sites or signals within the 3'-UTR <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B32">32</abbr></abbrgrp>. Recently, a systematic search discovered 106 highly conserved motifs in human 3'-UTRs that may be involved in post-transcriptional regulation, including mRNA stability and degradation <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Many of these are associated with microRNAs, which are non-coding RNAs of 21&#8211;22 nucleotides and are complementary to the 3'-UTR motifs that mediate post-transcriptional regulation <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. Similary, 53 sequence motifs have been catalogued in 3'-UTR of yeast mRNAs, including motifs corresponding to known RNA-binding protein sites and motifs associated with subcellular localization <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Furthermore, 83 disease-associated variants in the 3'-UTR of human protein-coding genes have been systematically analyzed, and that functionality of these variants correlated highly to predicted secondary structural changes <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>.</p>
         <p>Many studies are suggestive for Gata4 to network with other transcription factors to regulate cardiac gene expression (see reviews <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>). These protein-protein interactions are mediated through the proteins' binding domains and for Gata4, the zinc fingers are involved. For instance, N-terminal zinc finger interacts with Fog2, while the C-terminal zinc finger contacts Nkx2-5, Nf-At3, Mef2c and Hand2. Notably, the C-finger of Gata4 interacts with the third alpha helix (homeodomain) of Nkx2-5, to enable transcriptional synergy of regulated genes. Site-directed mutagenesis of zinc coordinating cysteines in the C-finger leads to abrogation of Gata4-Nkx2-5 interaction and loss of synergy <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. We reported previously the identification of somatically-derived GATA4 zinc finger mutations in the same malformed hearts, including a frequent mutation (p.Cys292Arg) in VSDs, which affects one of the four zinc coordinating cysteines and is predicted to disrupt the secondary structure of the protein <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. However, aside from p.Cys292Arg and unlike <it>NKX2-5 </it><abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp> common nonsynonymous mutations are rare in the coding regions of <it>GATA4</it>. Thus, the further detection of mutations in the 3'-UTR of <it>GATA4 </it>in the same malformed hearts with zinc finger mutations suggests a possible further mechanisms of disease, in which the zinc fingers are not involved. Indeed, as shown in Table <tblr tid="T3">3</tblr>, in which <it>GATA4 </it>nonsynonymous and 3'-UTR mutations identified in hearts with septation defects are summarized, there were 14 with 3'-UTR mutations only. These consist of 3 in VSDs, 3 in ASDs, and 8 in AVSDs. From these 14 hearts, 12 carried 3'-UTR mutations that are predicted to result in aberrant RNA folding. As can be surmised from Table <tblr tid="T3">3</tblr>, it appears that 3'-UTR mutations are more frequent in ASDs and AVSDs than in VSDs. In VSDs, 23 out of 29 had mutations in the coding region, most of which were p.Cys292Arg and only 9 out of 29, carried 3'-UTR mutations. It is also of considerable interest that sporadic cases of CHD from Lebanese population were analyzed for mutations affecting the zinc fingers and basic region of GATA4 <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. A mutation (p.Glu216Asp) in the N-terminal zinc finger was detected in 2/26 patients with Tetralogy of Fallot (TOF), and this mutation resulted in reduced transcriptional activity without affecting GATA4's ability to bind DNA, nor its interaction with ZFPM2 (FOG2). However, none of the other 94 patients with various CHD phenotypes carried any mutations.</p>
         <p>To help elucidate genetic alterations in affected tissues of malformed hearts, we have investigated in the past a panel of cardiac transcription factor genes from the same 68 malformed hearts <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B37">37</abbr></abbrgrp>. Direct sequencing revealed mutations in diseased tissues, which were basically absent in matched normal heart samples. Common occurring mutations were identified, especially in the binding domains of transcription factors, which could affect DNA-protein or protein-protein interactions leading to CHD. While certain transcription factor genes (<it>NKX2-5</it>, <it>GATA4</it>) exhibited a high rate of mutations, others were not or rarely affected (<it>HEY2, MEF2C</it>). Results of these studies enabled us to put forward a hypothesis of somatic mutations as a novel molecular cause of CHD. Furthermore, we found malformed hearts containing combination of mutations in the binding domains of several transcription factors, As example, we identified in two patients with AVSD combined mutations in the binding domains of HEY2, NKX2-5, TBX5 and GATA4 <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. We also identified 21 patients with combined mutations in the GATA4 zinc fingers and the homeodomain of NKX2-5 (unpublished results).</p>
         <p>Our malformed hearts were stored in formalin more than 40 years ago and there is speculation about artifacts arising from this procedure <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. To ensure reliability of our findings, we investigated sequence variations in 10 formalin-fixed, but healthy hearts which were collected at the same time as the malformed hearts. Essentially, these hearts were free of <it>GATA4 </it>mutations, therefore providing convincing evidence for reliability of the assay. In addition, our identification of six dbSNPs within the 3'-UTR demonstrates faithful preservation of DNA and reliability in using valuable retrospective material with the obvious advantage of studying clearly defined pathology, as opposed to using surrogate tissue material distal to organ defect. Five dbSNPs were highly polymorphic (see Table <tblr tid="T2">2</tblr>) and were found to be in Hardy-Weinberg equilibrium. This was confirmed with our control population of healthy individuals. But cloning of fragments amplified from diseased heart tissues of patients who were 'heterozygous' for three dbSNPs detected three haplotypes instead of the expected two, which may be due to duplication of <it>GATA4 </it>in analyzed tissues.</p>
         <p>This result is similar to our previous observations on different cardiac transcription factors conducted on the same set of malformed hearts <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B37">37</abbr></abbrgrp>. After cloning amplified fragments with several closely-spaced 'heterozygous' mutations as marker loci within a single gene, we observed several haplotypes in individual hearts, instead of two haplotypes as expected of a diploid genome. (Note, we used the term haplotype to define the set of alleles within an investigated gene locus). The cause of the observed multiple haplotypes is unknown, but may be explained by a mixed population of cardiomyocytes carrying different mutations or de novo chromosomal rearrangements and gene duplications in the heart tissues of patients affected by CHD. Our results for NKX2-5 by using a yeast-based assay to determine function suggest that different haplotypes can lead to different cardiac disease phenotypes <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. Furthermore, the presence of combined mutant alleles may alter/modify pattern of mRNA folding. We found, for instance, patients who were either positive for c.+218C>T or c.+259 A>G or both. Two patients were heterozygous for both mutations, while one patient was homozygous for both variant alleles. Singly c.+218C>T or c.+259 A>G would lead to misfolding (see Fig. <figr fid="F2">2</figr>), but if combined only the pattern observed for c.+259 A>G would result. Moreover, different haplotypes due to combinations of closely-spaced polymorphisms in the 3'-UTR of genes can result in different mRNA stabilities in transient expression assays <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Nonetheless, as the malformed hearts were conserved in formalin, possibilities exist that the observed multiple haplotypes could be PCR errors resulting from fragmented DNA. We believe the contrary, however, as specific haplotypes were detected in several malformed hearts after cloning, but were absent in matched unaffected heart tissue (unpublished results).</p>
         <p>To further support DNA assay reliability on the formalin-fixed material, we examined in the course of our work with the Leipzig heart collection, additional genes which have been associated with cardiac malformations. We searched for sequence variations affecting the binding domains of MEF2C and HEY2. In the case of <it>MEF2C </it>gene, no nonsynonymous mutations have been detected in a total of 68 patients with complex CHD (unpublished results). A similar finding was observed with the <it>HEY2 </it>gene, where only three nonsynonymous mutations were found in 2 of 52 patients <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. Our work on <it>TBX5 </it>in the same heart collection likewise supports reliability of using the material <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Mutations in this T-box transcription factor has been associated with Holt-Oram syndrome (HOS), a disorder characterized by heart and upper limb deformities <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. We amplified 200, 307, 276, 203 and 515 bp containing exons 3, 4, 5, 7 and 8, respectively in the same heart collection. The sequences encoding the T-box are located in exons 3, 4 and 5. We found a total of nine nonsynonymous mutations distributed in few patients with ASDs and AVSDs. None of the 29 VSDs carried any nonsynonymous mutations, only two synonymous mutations were found in two patients. To assess further method reliability, we investigated in the same patient cohort amplified fragments from other genes, with or without prior implication to heart development (e.g. <it>CFC1, HMGN4 </it>and <it>BRCC2)</it>, in the same heart collection, as well as in formalin-fixed normal mouse heart <it>s (e.g. Hand1, Nkx2-5 </it>and <it>Gata4) </it>but did not find sequence alterations <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We identified hotspots associated with cardiac defects in the 3'-UTR region. Our results suggest that somatic <it>GATA4 </it>mutations in the 3'-UTR may provide an additional molecular rationale for CHD</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <p>Materials, genomic DNA isolation, and mutation detection have been described previously <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Briefly, we analyzed 68 formalin-fixed hearts of Caucasians with complex cardiac malformations, notably n = 29 with ventricular (VSD), n = 16 with atrial (ASD), and n= 23 with atrioventricular (AVSD) septal defects. The explanted hearts, which were collected between 1954&#8211;1982, were obtained from the Institute of Anatomy, University of Leipzig, Germany. We also analyzed blood samples of 12 Caucasian patients with CHD, and blood samples of 100 unrelated healthy Caucasian individuals. In blood samples, defects of patients with CHD included VSD, ASD, hypoplastic left heart syndrome (HLHS), transposition of the great arteries (TGA), sub-pulmonary stenosis (SPS) and heterotaxy. Except for two patients who came from the same family, 10/12 patients were unrelated individuals. In the formalin-fixed malformed hearts, diseased tissues in the vicinity of the septal defects were analyzed. Matched healthy heart tissues were likewise investigated for sequence alterations. Materials used in this study were obtained in accordance to an approved protocol. JB has obtained approval to conduct genetic studies involving human materials from the Medical School Hannover. The formalin-fixed hearts were collected more than 40 years ago and cadavers were donated voluntarily by patients' relatives.</p>
         <p>The primers and PCR conditions used in investigating sequence variations of <it>GATA4 </it>are given in Table <tblr tid="T1">1</tblr>. PCR-amplified fragments were sequenced directly using BigDyeTerminator v3.1 Kit (Applied Biosystems, Darmstadt, Germany) and Applied Biosystems 3100 Genetic Analyzer. Sequences were analyzed using SeqScape 2.0 (Applied Biosystems) or DNASTAR Lasergene 6.0 (Madison, Wisconsin USA). The numbering of mutations within the coding region of <it>GATA4 </it>starts with nucleotide A of the first codon ATG, while that in the untranslated region was based on NM_002052. Nucleotide changes in the untranslated and intronic regions were numbered according to suggested nomenclature <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Sequence variations were verified by independent PCR, double-strand sequencing, PCR-RFLP, or cloning of heterozygous genotypes followed by subsequent sequencing of clones, allowing the identification of variant alleles. Unless reported as NCBI dbSNPs, we refer to nucleotide changes as sequence variations or mutations interchangeably, which simply means deviations from the reference <it>GATA4 </it>sequence (NM_002052), and disease-causing or not.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>CHD Congenital heart disease</p>
         <p>ASD Atrial septal defect</p>
         <p>VSD Ventricular septal defect</p>
         <p>AVSD Atrioventricular septal defect</p>
         <p>UTR Untranslated region</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>SMRB participated in the conceptual design of the study, was responsible for the lab work, carried out analysis and interpretation of the data, and drafted the manuscript. SHC participated in the screening, confirmation, and analysis of mutations as part of her M.D. project. JB was in-charge of the conceptual design of the study, participated in the analysis and interpretation of the data, and in the final writing of the manuscript. All authors have read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank the Institute of Anatomy, University of Leipzig for providing the heart collection, the Department of Cardiac Surgery and Pediatric Cardiology, University of Mainz for the blood samples of patients with CHD, Annika Roskowetz and Andreas Hiemisch for technical support. The financial support to JB of the Lower Saxony Ministry of Science and Culture is greatly appreciated.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Molkentin</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2000</pubdate>
            <volume>275</volume>
            <fpage>38949</fpage>
            <lpage>38952</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.R000029200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11042222</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>GATA transcription factors in the developing and adult heart</p>
            </title>
            <aug>
               <au>
                  <snm>Pikkarainen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tokola</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kerkela</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ruskoaho</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Cardiovasc Res</source>
            <pubdate>2004</pubdate>
            <volume>63</volume>
            <fpage>196</fpage>
            <lpage>207</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cardiores.2004.03.025</pubid>
                  <pubid idtype="pmpid" link="fulltext">15249177</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>GATA factors and transcriptional regulation of cardiac natriuretic peptide genes</p>
            </title>
            <aug>
               <au>
                  <snm>Temsah</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nemer</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Regul Pept</source>
            <pubdate>2005</pubdate>
            <volume>128</volume>
            <fpage>177</fpage>
            <lpage>185</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.regpep.2004.12.026</pubid>
                  <pubid idtype="pmpid" link="fulltext">15837526</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>GATA4 transcription factor is required for ventral morphogenesis and heart tube formation</p>
            </title>
            <aug>
               <au>
                  <snm>Kuo</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Morrisey</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Anandappa</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sigrist</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Parmacek</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Soudais</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Leiden</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Genes Dev</source>
            <pubdate>1997</pubdate>
            <volume>11</volume>
            <fpage>1048</fpage>
            <lpage>1060</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gad.11.8.1048</pubid>
                  <pubid idtype="pmpid" link="fulltext">9136932</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Molkentin</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Duncan</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>EN</fnm>
               </au>
            </aug>
            <source>Genes Dev</source>
            <pubdate>1997</pubdate>
            <volume>11</volume>
            <fpage>1061</fpage>
            <lpage>1072</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gad.11.8.1061</pubid>
                  <pubid idtype="pmpid" link="fulltext">9136933</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Gata4 regulates the formation of multiple organs. Development</p>
            </title>
            <aug>
               <au>
                  <snm>Holtzinger</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Evans</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <pubdate>1997</pubdate>
            <volume>132</volume>
            <issue>17</issue>
            <fpage>4005</fpage>
            <lpage>4014</lpage>
         </bibl>
         <bibl id="B7">
            <title>
               <p>GATA-4:FOG interactions regulate gastric epithelial development in the mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Jacobsen</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Mannisto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Porter-Tinge</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Genova</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Parviainen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Heikinheimo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Adameyko</snm>
                  <fnm>II</fnm>
               </au>
               <au>
                  <snm>Tevosian</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>DB</fnm>
               </au>
            </aug>
            <source>Dev Dyn</source>
            <pubdate>2005</pubdate>
            <volume>234</volume>
            <fpage>355</fpage>
            <lpage>362</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/dvdy.20552</pubid>
                  <pubid idtype="pmpid" link="fulltext">16127717</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>GATA4 mutations cause human congenital heart defects and reveal an interaction with TBX5</p>
            </title>
            <aug>
               <au>
                  <snm>Garg</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Kathiriya</snm>
                  <fnm>IS</fnm>
               </au>
               <au>
                  <snm>Barnes</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schluterman</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>IN</fnm>
               </au>
               <au>
                  <snm>Butler</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Rothrock</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Eapen</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Hirayama-Yamada</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Joo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Matsuoka</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Srivastava</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2003</pubdate>
            <volume>424</volume>
            <fpage>443</fpage>
            <lpage>447</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature01827</pubid>
                  <pubid idtype="pmpid" link="fulltext">12845333</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>A novel GATA4 mutation completely segregated with atrial septal defect in a large Japanese family</p>
            </title>
            <aug>
               <au>
                  <snm>Okubo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Miyoshi</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Takagi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tsukamoto</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kinoshita</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yoshiura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kishino</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohta</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Niikawa</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Med Genet</source>
            <pubdate>2004</pubdate>
            <volume>41</volume>
            <fpage>e97</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jmg.2004.018895</pubid>
                  <pubid idtype="pmpid" link="fulltext">15235040</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Spectrum of atrial septal defects associated with mutations of NKX2.5 and GATA4 transcription factors</p>
            </title>
            <aug>
               <au>
                  <snm>Sarkozy</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Conti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Neri</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>D'Agostino</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Digilio</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Esposito</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Toscano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Marino</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Pizzuti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dallapiccola</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>J Med Genet</source>
            <pubdate>2005</pubdate>
            <volume>42</volume>
            <fpage>e16</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jmg.2004.026740</pubid>
                  <pubid idtype="pmpid" link="fulltext">15689439</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Phenotypes with GATA4 or NKX2.5 mutations in familial atrial septal defect</p>
            </title>
            <aug>
               <au>
                  <snm>Hirayama-Yamada</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kamisago</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Akimoto</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Aotsuka</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Furutani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Imamura</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Takao</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nakazawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Matsuoka</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Am J Med Genet A</source>
            <pubdate>2005</pubdate>
            <volume>135</volume>
            <fpage>47</fpage>
            <lpage>52</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15810002</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Mutations in human TBX5 cause limb and cardiac malformation in Holt-Oram syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Basson</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Bachinsky</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Levi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Elkins</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Soults</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Grayzel</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kroumpouzou</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Traill</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Leblanc-Straceski</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Renault</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kucherlapati</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Seidman</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Seidman</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>1997</pubdate>
            <volume>15</volume>
            <fpage>30</fpage>
            <lpage>35</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng0197-30</pubid>
                  <pubid idtype="pmpid" link="fulltext">8988165</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>CRELD1 and GATA4 gene analysis in patients with nonsyndromic atrioventricular canal defects</p>
            </title>
            <aug>
               <au>
                  <snm>Sarkozy</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Esposito</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Conti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Digilio</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Marino</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Calabro</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pizzuti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dallapiccola</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Am J Med Genet</source>
            <pubdate>2005</pubdate>
            <volume>139</volume>
            <issue>3</issue>
            <fpage>236</fpage>
            <lpage>238</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ajmg.a.31018</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Somatic gene mutation and human disease other than cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Erickson</snm>
                  <fnm>RP</fnm>
               </au>
            </aug>
            <source>Mutat Res</source>
            <pubdate>2003</pubdate>
            <volume>543</volume>
            <fpage>125</fpage>
            <lpage>136</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1383-5742(03)00010-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12644182</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Autoimmune lymphoproliferative syndrome with somatic Fas mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Holzelova</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Vonarbourg</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Stolzenberg</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Arkwright</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Selz</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Prieur</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Blanche</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bartunkova</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Vilmer</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Le Deist</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Rieux-Laucat</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>2004</pubdate>
            <volume>351</volume>
            <fpage>1409</fpage>
            <lpage>1418</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJMoa040036</pubid>
                  <pubid idtype="pmpid" link="fulltext">15459302</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Novel NKX2-5 mutations in diseased heart tissues of patients with cardiac malformations</p>
            </title>
            <aug>
               <au>
                  <snm>Reamon-Buettner</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Hecker</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Spanel-Borowski</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Craatz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kuenzel</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Borlak</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2004</pubdate>
            <volume>164</volume>
            <fpage>2117</fpage>
            <lpage>2125</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1615780</pubid>
                  <pubid idtype="pmpid" link="fulltext">15161646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Somatic NKX2-5 mutations as a novel mechanism of disease in complex congenital heart disease</p>
            </title>
            <aug>
               <au>
                  <snm>Reamon-Buettner</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Borlak</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Med Genet</source>
            <pubdate>2004</pubdate>
            <volume>41</volume>
            <fpage>684</fpage>
            <lpage>690</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jmg.2003.017483</pubid>
                  <pubid idtype="pmpid" link="fulltext">15342699</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>TBX5 mutations in Non-Holt-Oram Syndrome (HOS) malformed hearts</p>
            </title>
            <aug>
               <au>
                  <snm>Reamon-Buettner</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Borlak</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <fpage>104</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.9255</pubid>
                  <pubid idtype="pmpid" link="fulltext">15221798</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>GATA4 zinc finger mutations as a molecular rationale for septation defects of the human heart</p>
            </title>
            <aug>
               <au>
                  <snm>Reamon-Buettner</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Borlak</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Med Genet</source>
            <pubdate>2005</pubdate>
            <volume>42</volume>
            <fpage>e32</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jmg.2004.025395</pubid>
                  <pubid idtype="pmpid" link="fulltext">15863664</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>3'-Untranslated regions are important in mRNA localization and translation: lessons from selenium and metallothionein</p>
            </title>
            <aug>
               <au>
                  <snm>Hesketh</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Biochem Soc Trans</source>
            <pubdate>2004</pubdate>
            <volume>32</volume>
            <fpage>990</fpage>
            <lpage>993</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1042/BST03209990</pubid>
                  <pubid idtype="pmpid" link="fulltext">15506944</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>The 3' untranslated region of messenger RNA: A molecular 'hotspot' for pathology?</p>
            </title>
            <aug>
               <au>
                  <snm>Conne</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Stutz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Vassalli</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2000</pubdate>
            <volume>6</volume>
            <fpage>637</fpage>
            <lpage>641</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/76211</pubid>
                  <pubid idtype="pmpid" link="fulltext">10835679</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism</p>
            </title>
            <aug>
               <au>
                  <snm>Shibayama</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cook</snm>
                  <fnm>EH</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Glanzmann</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Yan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Craddock</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Goldman</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Heston</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Sommer</snm>
                  <fnm>SS</fnm>
               </au>
            </aug>
            <source>Am J Med Genet B Neuropsychiatr Genet</source>
            <pubdate>2004</pubdate>
            <volume>128</volume>
            <fpage>50</fpage>
            <lpage>53</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ajmg.b.30016</pubid>
                  <pubid idtype="pmpid" link="fulltext">15211631</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Lack of the architectural factor HMGA1 causes insulin resistance and diabetes in humans and mice</p>
            </title>
            <aug>
               <au>
                  <snm>Foti</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chiefari</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fedele</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iuliano</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Brunetti</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Paonessa</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Manfioletti</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Barbetti</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Brunetti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Croce</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Fusco</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Brunetti</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2005</pubdate>
            <volume>11</volume>
            <fpage>765</fpage>
            <lpage>773</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm1254</pubid>
                  <pubid idtype="pmpid" link="fulltext">15924147</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion</p>
            </title>
            <aug>
               <au>
                  <snm>Den Dunnen</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Antonarakis</snm>
                  <fnm>SE</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2000</pubdate>
            <volume>15</volume>
            <fpage>7</fpage>
            <lpage>12</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1098-1004(200001)15:1&lt;7::AID-HUMU4>3.0.CO;2-N</pubid>
                  <pubid idtype="pmpid" link="fulltext">10612815</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>An eleven nucleotide section of the 3'-untranslated region is required for perinuclear localization of rat metallothionein-1 mRNA</p>
            </title>
            <aug>
               <au>
                  <snm>Nury</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chabanon</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Levadoux-Martin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hesketh</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Biochem J</source>
            <pubdate>2005</pubdate>
            <volume>387</volume>
            <fpage>419</fpage>
            <lpage>428</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1134970</pubid>
                  <pubid idtype="pmpid" link="fulltext">15537387</pubid>
                  <pubid idtype="doi">10.1042/BJ20040630</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals</p>
            </title>
            <aug>
               <au>
                  <snm>Xie</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kulbokas</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Golub</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Mootha</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Lindblad-Toh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lander</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Kellis</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2005</pubdate>
            <volume>434</volume>
            <fpage>338</fpage>
            <lpage>345</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03441</pubid>
                  <pubid idtype="pmpid" link="fulltext">15735639</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>GATA4 is a dosage-sensitive regulator of cardiac morphogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Pu</snm>
                  <fnm>WT</fnm>
               </au>
               <au>
                  <snm>Ishiwata</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Juraszek</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Izumo</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Dev Biol</source>
            <pubdate>2004</pubdate>
            <volume>275</volume>
            <fpage>235</fpage>
            <lpage>244</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ydbio.2004.08.008</pubid>
                  <pubid idtype="pmpid" link="fulltext">15464586</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Morphogenesis of the right ventricle requires myocardial expression of Gata4</p>
            </title>
            <aug>
               <au>
                  <snm>Zeisberg</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Juraszek</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Moses</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Izumo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pu</snm>
                  <fnm>WT</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>2005</pubdate>
            <volume>115</volume>
            <fpage>1522</fpage>
            <lpage>1531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1090473</pubid>
                  <pubid idtype="pmpid" link="fulltext">15902305</pubid>
                  <pubid idtype="doi">10.1172/JCI23769</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>The cardiac tissue-restricted homeobox protein Csx/Nkx2.5 physically associates with the zinc finger protein GATA4 and cooperatively activates atrial natriuretic factor gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shioi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kasahara</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Jobe</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Wiese</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Markham</snm>
                  <fnm>BE</fnm>
               </au>
               <au>
                  <snm>Izumo</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1998</pubdate>
            <volume>18</volume>
            <fpage>3120</fpage>
            <lpage>3129</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">108894</pubid>
                  <pubid idtype="pmpid" link="fulltext">9584153</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>GATA-4 and Nkx-2.5 coactivate Nkx-2 DNA binding targets: role for regulating early cardiac gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Sepulveda</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Belaguli</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nigam</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Nemer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1998</pubdate>
            <volume>18</volume>
            <fpage>3405</fpage>
            <lpage>3415</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">108922</pubid>
                  <pubid idtype="pmpid" link="fulltext">9584181</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>A faux 3'-UTR promotes aberrant termination and triggers nonsense-mediated mRNA decay</p>
            </title>
            <aug>
               <au>
                  <snm>Amrani</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ganesan</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kervestin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mangus</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Ghosh</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jacobson</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2004</pubdate>
            <volume>432</volume>
            <fpage>112</fpage>
            <lpage>118</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03060</pubid>
                  <pubid idtype="pmpid" link="fulltext">15525991</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Annexin A2 binds to the localization signal in the 3' untranslated region of c-myc mRNA</p>
            </title>
            <aug>
               <au>
                  <snm>Mickleburgh</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Burtle</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hollas</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Chrzanowska-Lightowlers</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Vedeler</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hesketh</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>FEBS J</source>
            <pubdate>2005</pubdate>
            <volume>272</volume>
            <fpage>413</fpage>
            <lpage>421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1742-4658.2004.04481.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15654879</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation</p>
            </title>
            <aug>
               <au>
                  <snm>Lai</snm>
                  <fnm>EC</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <fpage>363</fpage>
            <lpage>364</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng865</pubid>
                  <pubid idtype="pmpid" link="fulltext">11896390</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>A catalog of stability-associated sequence elements in 3' UTRs of yeast mRNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Shalgi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lapidot</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shamir</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pilpel</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>R86</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1257469</pubid>
                  <pubid idtype="pmpid" link="fulltext">16207357</pubid>
                  <pubid idtype="doi">10.1186/gb-2005-6-10-r86</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>A systematic analysis of disease-associated variants in the 3' regulatory regions of human protein-coding genes II: the importance of mRNA secondary structure in assessing the functionality of 3' UTR variants</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Ferec</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>DN</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2006</pubdate>
            <volume>120</volume>
            <fpage>301</fpage>
            <lpage>333</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00439-006-0218-x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16807757</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>A novel mutation in the GATA4 gene in patients with Tetralogy of Fallot</p>
            </title>
            <aug>
               <au>
                  <snm>Nemer</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Fadlalah</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Usta</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nemer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dbaibo</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Obeid</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bitar</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2006</pubdate>
            <volume>27</volume>
            <fpage>293</fpage>
            <lpage>294</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.9410</pubid>
                  <pubid idtype="pmpid" link="fulltext">16470721</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>HEY2 mutations in malformed hearts</p>
            </title>
            <aug>
               <au>
                  <snm>Reamon-Buettner</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Borlak</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2006</pubdate>
            <volume>27</volume>
            <fpage>118</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.9390</pubid>
                  <pubid idtype="pmpid" link="fulltext">16329098</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Mutations in BRCA1 from fixed, paraffin-embedded tissue can be artifacts of preservation</p>
            </title>
            <aug>
               <au>
                  <snm>Wong</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>DiCioccio</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Werness</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Piver</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Cancer Genet Cytogenet</source>
            <pubdate>1998</pubdate>
            <volume>107</volume>
            <fpage>21</fpage>
            <lpage>27</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0165-4608(98)00079-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">9809029</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>A high frequency of sequence alterations is due to formalin fixation of archival specimens</p>
            </title>
            <aug>
               <au>
                  <snm>Williams</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ponten</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Moberg</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Soderkvist</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Uhlen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ponten</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sitbon</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lundeberg</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>1999</pubdate>
            <volume>155</volume>
            <fpage>1467</fpage>
            <lpage>1471</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1866966</pubid>
                  <pubid idtype="pmpid" link="fulltext">10550302</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Absence of mutation in the putative tumor-suppressor gene KLF6 in colorectal cancers</p>
            </title>
            <aug>
               <au>
                  <snm>Lievre</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Landi</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Cote</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Veyrie</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Zucman-Rossi</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Berger</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Laurent-Puig</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2005</pubdate>
            <volume>24</volume>
            <fpage>7253</fpage>
            <lpage>7256</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.onc.1208867</pubid>
                  <pubid idtype="pmpid" link="fulltext">16044160</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Functional dissection of sequence-specific NKX2-5 DNA binding domain mutations associated with human heart septation defects using a yeast-based system</p>
            </title>
            <aug>
               <au>
                  <snm>Inga</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Reamon-Buettner</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Borlak</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Resnick</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <fpage>1965</fpage>
            <lpage>1975</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi202</pubid>
                  <pubid idtype="pmpid" link="fulltext">15917268</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <aug>
               <au>
                  <cnm>GeneView</cnm>
               </au>
            </aug>
            <url>http://www.ensembl.org/Homosapiens/geneview</url>
         </bibl>
         <bibl id="B43">
            <aug>
               <au>
                  <cnm>Zuker's RNA folding algorithm</cnm>
               </au>
            </aug>
            <url>http://www.bioinfo.rpi.edu/~zukerm/seqanal/</url>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2350/8/38/prepub</url>
         </p>
      </sec>
   </bm>
</art>
