<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2334-6-98</ui>
   <ji>1471-2334</ji>
   <fm>
      <dochead>Technical advance</dochead>
      <bibl>
         <title>
            <p>Usefulness of real time PCR for the differentiation and quantification of 652 and JP2 Actinobacillus actinomycetemcomitans genotypes in dental plaque and saliva</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Orr&#249;</snm>
               <fnm>Germano</fnm>
               <insr iid="I1"/>
               <email>orru@unica.it</email>
            </au>
            <au id="A2">
               <snm>Marini</snm>
               <mnm>Francesco</mnm>
               <fnm>Mario</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>mfmarini@yahoo.it</email>
            </au>
            <au id="A3">
               <snm>Ciusa</snm>
               <mnm>Laura</mnm>
               <fnm>Maria</fnm>
               <insr iid="I1"/>
               <email>laciusa@gmail.com</email>
            </au>
            <au id="A4">
               <snm>Isola</snm>
               <fnm>Daniela</fnm>
               <insr iid="I1"/>
               <email>disola@hotmail.com</email>
            </au>
            <au id="A5">
               <snm>Cotti</snm>
               <fnm>Marina</fnm>
               <insr iid="I1"/>
               <email>marinacotti@tiscalinet.it</email>
            </au>
            <au id="A6">
               <snm>Baldoni</snm>
               <fnm>Marco</fnm>
               <insr iid="I2"/>
               <email>marco.baldoni@unimib.it</email>
            </au>
            <au id="A7">
               <snm>Piras</snm>
               <fnm>Vincenzo</fnm>
               <insr iid="I1"/>
               <email>vpiras@unica.it</email>
            </au>
            <au id="A8">
               <snm>Pisano</snm>
               <fnm>Elisabetta</fnm>
               <insr iid="I1"/>
               <email>episano@pacs.unica.it</email>
            </au>
            <au id="A9">
               <snm>Montaldo</snm>
               <fnm>Caterina</fnm>
               <insr iid="I1"/>
               <email>montaldc@unica.it</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>O.B.L. (Oral Biotechnology Laboratory), Dipartimento di Chirurgia e Odontostomatologia Universit&#224; degli Studi di Cagliari, Cagliari, Italy</p>
            </ins>
            <ins id="I2">
               <p>Universita' degli Studi Milano Bicocca, Dipartimento di Neuroscienze, Dottorato di Ricerca in Parodontologia Sperimentale, Milano, Italy</p>
            </ins>
         </insg>
         <source>BMC Infectious Diseases</source>
         <issn>1471-2334</issn>
         <pubdate>2006</pubdate>
         <volume>6</volume>
         <issue>1</issue>
         <fpage>98</fpage>
         <url>http://www.biomedcentral.com/1471-2334/6/98</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16772039</pubid>
               <pubid idtype="doi">10.1186/1471-2334-6-98</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>07</day>
               <month>2</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>13</day>
               <month>6</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>13</day>
               <month>6</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Orr&#249; et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The aim of our study is to describe a fast molecular method, able to distinguish and quantize the two different genotypes (652 and JP2) of an important periodontal pathogen: <it>Actinobacillus actinomycetemcomitans</it>. The two genotypes show differences in the expression of an important pathogenic factor: the leukotoxin (ltx). In order to evidence this, we performed a real time PCR procedure on the ltx operon, able to recognize <it>Aa </it>clinical isolates with different leukotoxic potentials.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>The specificity of the method was confirmed in subgingival plaque and saliva specimens collected from eighty-one Italian (Sardinian) subjects with a mean age of 43.9, fifty five (68 %) of whom had various clinical forms of periodontal disease.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>This procedure showed a good sensitivity and a high linear dynamic range of quantization (10<sup>7</sup>-10<sup>2 </sup>cells/ml) for all genotypes and a good correlation factor (R2 = 0.97&#8211;0.98). Compared with traditional cultural methods, this real time PCR procedure is more sensitive; in fact in two subgingival plaque and two positive saliva specimens <it>Aa </it>was only detected with the molecular method.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>A low number of Sardinian patients was found positive for <it>Aa </it>infections in the oral cavity, (just 10 positive periodontal cases out of 81 and two of these were also saliva positive). The highly leukotoxic JP2 strain was the most representative (60 % of the positive specimens); the samples from periodontal pockets and from saliva showed some <it>ltx </it>genotype for the same patient. Our experience suggests that this approach is suitable for a rapid and complete laboratory diagnosis for <it>Aa </it>infection.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Actinobacillus actinomycetemcomitans </it>(<it>Aa</it>) is a gram-negative, facultative anaerobe, implicated in numerous human diseases such as periodontitis, endocarditis, meningitis and osteomyelitis. <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. The primary ecological niches of this bacteria, which causes localized aggressive periodontitis, are dental plaque and periodontal pockets and its presence mainly occurs in chronic adult periodontitis <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>.<it>Aa </it>has been studied because it produces a powerful leukotoxin (ltx) able to kill human leukocytes <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Most of the <it>Aa </it>strains isolated from non-diseased periodontal sites produce low levels of leukotoxin, while aggressive forms of <it>Aa </it>-associated periodontitis show highly leukotoxic microrganism clones <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B46">46</abbr></abbrgrp>. The leukotoxin is expressed by an operon consisting of four genes (<it>ltx C, ltx A, ltx B, ltx D</it>); ltx A is the functional toxin while the three remaining genes are required for activating and transporting the leukotoxin <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B14">14</abbr></abbrgrp>. Different transcription levels of ltx can depend on a specific 530-bp sequence in the ltx promoter region, which leads to both lower expression and toxicity (strain 652). When this region is deleted (this occurs in strain JP2) there is a faster ltx production which leads to a better protein transcription than in strain 652: this seems to be responsible for the periodontal destruction <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>.</p>
         <p>Standard culture methods used for <it>Aa </it>detection in clinical samples have some disadvantages such as the need for a required nutritionally complex media for growth and several days of incubation <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Molecular assays for <it>Aa </it>detection are based on DNA-probes, PCR and real time PCR methods; they are faster and more sensitive than cultural systems, although they do not allow a simultaneous detection and quantization of the different genotypes <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. To overcome these outbreaks we used a real time PCR method for the differentiation and quantization of <it>Aa </it>652/JP2 strains, based on the different length of PCR products in the two genotypes; this method is based on the principle that, by using SYBR Green I, the melting temperature (T<sub>m</sub>) of the PCR product gives information about the sequence length and also allows different genotype amplicons to be identified and quantified.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Clinical specimens</p>
            </st>
            <p>Subgingival plaque and saliva samples were collected from 81 male and female subjects, aged from 7 to 81, recruited from the Department of Dental Disease Prevention (University of Cagliari), who had given informed consent to take part in the microbiological analysis. The patient's conditions were: non-diseased (n = 26.32%), with gingivitis (n = 31, 38.3%), with chronic periodontitis (n = 17.21%) and with aggressive periodontitis (n = 7, 8.7%) <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Each patient's health status and background were recorded: age, sex, probing pocket depth, clinical attachment level, bleeding on probing (measured in six sites on all teeth present in the mouth). None of the patients who took part in the experiments was under antibiotic therapy during the previous 6 months. At first, 400 &#956;l of saliva was collected from each patient and placed into a sterile tube, afterwards the subgingival plaque samples were obtained (one site per patient) from the deepest periodontal sites in all subjects. The sample area was isolated using sterile cotton rolls and air-dried to avoid saliva contamination; supragingival plaque was removed by using a sterile curette. A sterile paper point ISO 45 (Roeko Dental, Langenau, Germany) was inserted into the pocket and held in place for 30 seconds <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. The paper point was then removed and placed into a vial containing 800 &#956;l of sterile saline solution, NaCl 0.9%, with 15 glass beads (about 100 mg Bio-Spec Products, Bartesville, USA). After vigorous vortexing, 200 &#956;l of the suspension was immediately used for culture analysis, while the remaining suspension (600 ul) was stored at -20&#176;C and 400 ul of this were used for DNA extraction.</p>
         </sec>
         <sec>
            <st>
               <p>Positive control strains</p>
            </st>
            <sec>
               <st>
                  <p>a) Aa strains</p>
               </st>
               <p>The <it>Aa </it>strains used were: (i) CCUG 37005 (Culture Collection, University of G&#246;teborg, Sweden, genotype 652) and (ii) clinical isolate, strain GO1 (genotype JP2). The two strains were maintained at -80&#176;C in vials containing Schaedler Broth with 15% glycerol and cultured in Columbia agar blood (Microbiol, UTA, Cagliari, Italy) at 37&#176;C with 5% CO<sub>2 </sub>in jar (Biom&#233;rieux Marcy l'Etoile, France). After 1 week of incubation, colonies of each genotype were suspended in a sterile saline solution (NaCl 0.9%) to obtain a concentration of 1 McFarland scale 3*10<sup>8 </sup>cells/ml (counted with the McFarland method) these suspensions were used as follows:</p>
               <p>1. to assess specificity: we prepared different suspensions in 400 &#956;l of sterile saliva (obtained by filtration with a 0.5 &#956;m filter, Millipore Molseim, France), (i) containing 10<sup>6 </sup>CELLS/ml of each genotype and (ii) tubes with different proportional mixtures of the two genotypes, 1/2, 1/4, 1/8, 1/10 652/JP2 or <it>vice versa</it>)</p>
               <p>2. to assess sensitivity: we prepared 10 fold serial dilutions of each genotype in sterile saliva, ranging from 10<sup>7 </sup>-10<sup>1 </sup>cells/ml.</p>
               <p>The exact bacterial concentration of these standards was obtained by colony forming unit (CFU) plate counted in Columbia agar blood (Microbiol, Uta, Cagliari, Italy. These suspensions served as a standard for measuring the method sensitivity and for the quantification curve after DNA extraction.</p>
            </sec>
            <sec>
               <st>
                  <p>b) Other periodontal bacteria used as positive control</p>
               </st>
               <p>To assess the role of other periodontal pathogens in these samples, a traditional PCR was used with subsequent positive controls: <it>Porphyromonas gingivalis </it>CCUG 25893, <it>Prevotella intermedia </it>CCUG 24041, (Culture Collection, University of G&#246;teborg, Sweden), <it>Tannerella forsythensis </it>cip 105220 (Institut Pasteur, Paris, France) <it>Treponema denticola </it>DSMZ 14222-Deutsche <it>Sammlung von Mikroorganismen</it>, Braunschweig, Germany. These strains (except <it>T.denticola</it>) were cultured on Shaedler Anaerobe Agar plates (Microbiol, Uta, Cagliari, Italy), incubated in an anaerobic jar for 7 days at 37&#176;C. 1 ml of these bacterial suspensions was used for DNA extraction.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>DNA extraction</p>
            </st>
            <p>Genomic DNA from positive controls and clinical samples was obtained by the CTAB modified method. 400 &#956;l of sample were added to 70 &#956;l of 10% sodium dodecyl sulphate (SDS) and 5 &#956;l of proteinase K at 10 mg/ml concentration (SIGMA &#8211; Aldrich, ST. Louis, Missouri, USA); after vigorous vortexing, this mixture was incubated for 10 minutes at 65&#176;C. Next, 100 &#956;l of NaCl [5 M] and 100 &#956;l of CTAB/NaCl (0.274 M CTAB, Hexadecyl trimetylammonium bromide and 0.877 M NaCl, Sigma-Aldrich) were added to the tube, which was vortexed briefly and incubated at 65&#176;C for 10 minutes. 750 &#956;l of SEVAG (Chloroform: Isoamyl Alcohol 24:1, Sigma-Aldrich) were added and the mixture was vortexed for 10 sec. After centrifuging for 5 min (at 12000 rpm) 0.6 volumes of isopropanol (Sigma-Aldrich) were added to the supernatant. After 30 min at -20&#176;C and after being centrifuged for 30 min at 12.000 rpm, the pellet was dried at room temperature for 20 min and suspended in 20 &#956;l of molecular biology grade distilled water (Gibco, Invitrogen Paisley, Scotland, UK). 2 &#956;l of this were used as DNA suspension for conventional PCR and real time PCR reaction.</p>
         </sec>
         <sec>
            <st>
               <p>Primers design</p>
            </st>
            <p>Primers for real time PCR were designed using the promoter region on the Leukotoxin operon sequences extracted from the NCBI database GenBank with <ext-link ext-link-type="gen" ext-link-id="S68133">S68133</ext-link> and <ext-link ext-link-type="gen" ext-link-id="M27399">M27399</ext-link> accession numbers. Figure <figr fid="F1">1</figr> shows primer sequence and position and the real time PCR mechanism with the two different (652/JP2) Aa genotypes. Possible oligonucleotide dimer formation, self-complementarity and the annealing temperatures of the real time PCR were calculated using the Oligo program vers. 4 (MedProbe, Oslo, Norway). The real time PCR primers (OG155 and OG156) amplified a region of 696 bp in the 652 genotype and 195 bp in the JP2 genotype (Figure <figr fid="F1">1</figr>). The theoretic melting temperatures of the different PCR amplicons (Tms) were calculated using module 1 of the DNA hybridization prediction algorithm program "HYTHER" <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B50">50</abbr></abbrgrp> with the following sets of parameters: (i) monovalent cation concentration at 0.05 mol/L, (ii) Mg<sup>2+ </sup>at 0.004 mol/L, (iii) a concentration of PCR products (Top/Bottom strands) at 10<sup>-7 </sup>mol/L and (iv) hybridisation temperature at 37&#176;C. The same procedures have been used to design all the oligonucleotides used in traditional PCR (Table <tblr tid="T1">1</tblr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Structure of Real time PCR design for <it>Actinobacillus actinomycetemcomitans </it>652, JP2 genotype detection</p>
               </caption>
               <text>
                  <p><b>Structure of Real time PCR design for <it>Actinobacillus actinomycetemcomitans </it>652, JP2 genotype detection</b>. Primers were designed to circumscribe a fragment of 530 bp present in 652 but deleted in the JP2 strain. The two different PCR products showed 6 &#176;C difference in T<sub>m</sub>s after PCR real time melting curve analysis.</p>
               </text>
               <graphic file="1471-2334-6-98-1"/>
            </fig>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primers used and strains detected by conventional PCR.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Name</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Target</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Strain</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sequence 5'--------------3'</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>GenBank Accession No</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PCR product (bp)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG 43</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Actinobacillus actimycetemcomitans</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CCAAGTGTGATTAGGTAGTT</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="M75036">M75036</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>226</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG 44</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Actinobacillus actimycetemcomitans</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACCAACCTTCCTCAATAC</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="M75036">M75036</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG53</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Prevotella intermedia</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CGTATCCAACCTTCCCTCC</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="X73965">X73965</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>389</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG54</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Prevotella intermedia</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ATTAGCCGGTCCTTATTCGAAG</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="X73965">X73965</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG94</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>prtC</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Porphyromonas gingivalis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GAATCAAATACTTCAGCCGTCT</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AB006973">AB006973</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>143</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG95</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>prtC</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Porpyromonas gingivalis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TTGCAGTTCGTATCGGATCT</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AB006973">AB006973</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG45</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Tannerella forsythensis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GTCGGACTAATACCTCATAAAACA</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="L16495">L16495</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>222</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG46</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Tannerella forsythensis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TCGCCCATTGACCAATATT</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="L16495">L16495</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG348</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Treponema denticola</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>AGAGAAAGGGTAATTTGAAG</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF179264">AF179264</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>399</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>OG349</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>16S rRNA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Treponema denticola</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TATTATTGTCCCTTCTTTCTT</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF179264">AF179264</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Real time PCR</p>
            </st>
            <p>Real time PCR was performed with a LightCycler instrument and a LightCycler DNA Master SYBR Green I kit (Roche Diagnostics Mannheim, Germany), according to the manufacturer's instructions. The 20 &#956;l final volume contained 4 mM MgCl<sub>2</sub>, 1 &#956;M of each primer (OG155-OG156) and 2 &#956;l of DNA extract. The PCR program was: (i) denaturation at 95&#176;C for 30 sec, (ii) 40 cycles of: 1 sec at 95&#176;C, 10 sec at 49&#176;C, 40 sec at 72&#176;C and 3 sec at 74.3&#176;C. (iii) The melting curve was performed for 0 seconds at 95&#176;C, 45&#176;C, 95&#176;C. Transition rates were: 5&#176;C/s in 72&#176;C segment, 0.1&#176;C/s in 45 &#176;C segment and 20 &#176;C/s for other steps. Fluorescence was detected at the end of the 74.3&#176;C segment in the PCR step (single mode), and at 45&#176;C segment in the melting step (continuous mode) in the F1 channel. During the initial optimization of the real time reaction, products were analyzed using agarose gel to ensure a correct sample product size. After real time PCR, samples were recovered from capillaries by reverse centrifugation into microcentrifuge tubes (Eppendorf 0.2 &#956;l), and mixed with blue loading buffer and finally 10 &#956;l of each sample were utilized in 1% agarose electrophoresis gel (Invitrogen, Palsley, Scotland, UK) and stained with ethidium bromide.</p>
         </sec>
         <sec>
            <st>
               <p>Differentiation between JP2 and 652 genotypes</p>
            </st>
            <p>By using two primers (OG155 and OG156) flanking an ltx promoter region, we obtained two different length PCR products: 696 bp for 652 and 195 bp for the JP2 genotype. These amplicons showed two different T<sub>m</sub>s melting peaks after the PCR real time reaction with SYBR green I dye. To evaluate product specificity, ltx PCR amplicons were also sequenced by a conventional automated sequencer as described in literature by Ianelli et al.,1998, <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. The results were edited and analyzed with nucleotide-nucleotide BLAST (blastn) <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> and compared with sequences deposited in the DNA data bank.</p>
         </sec>
         <sec>
            <st>
               <p>Expression of the Aa concentration in dental plaque and saliva</p>
            </st>
            <p>Real time PCR standard curves were performed on different DNA extracts, obtained by different <it>Aa </it>genotype suspensions with a concentration range of 10<sup>7</sup>-10<sup>1 </sup>cells/ml. The number of bacteria was calculated by the interpolation of the clinical sample threshold cycle <abbrgrp><abbr bid="B39">39</abbr></abbrgrp> with a standard curve obtained for each genotype (Figure <figr fid="F4">4</figr>). Bacterial concentration in specimens was expressed in: i) <it>Aa </it>cells/ml paper point suspension for subgingival plaque and ii) <it>Aa </it>cells/ml saliva in saliva samples. We used the following equation to calculate <it>Aa </it>concentration for the paper point specimens.</p>
            <p>a) [cells/ml paper point suspension].= ([<it>Aa </it>Rt cells]*2,5.</p>
            <p>[Aa Rt cells]= Bacterial cells, calculated by PCR real time standard curve interpolation.</p>
         </sec>
         <sec>
            <st>
               <p>Cultural method</p>
            </st>
            <p>For a sensitivity study, molecular methods were compared with traditional culture analysis for all the clinical samples: 200 &#956;l of saliva and paper point suspensions were diluted 10 and 100 fold in Schaedler Broth (Microbiol, Uta, Cagliari, Italy). 100 &#956;l of each dilution were plated in Columbia agar blood (Microbiol, Uta, Cagliari, Italy) and incubated in a 15% CO<sub>2 </sub>atmosphere at 37&#176;C in a jar using the Genbox system (Biom&#233;rieux Marcy l'Etoile, France). After 6 days of incubation the typical <it>Aa </it>colonies were identified by a biochemical test using API 20A (Biom&#233;rieux Marcy l'Etoile, France) according to the manufacturer's instructions.</p>
         </sec>
         <sec>
            <st>
               <p>Conventional PCR</p>
            </st>
            <p>For the 81 analyzed samples we used traditional PCR able to detect: (i) <it>A. actinomycetemcomitans </it>by different DNA target (16S rRNA) and (ii) <it>P. gingivalis, P. intermedia</it>, <it>T. forsythensis</it>, <it>T. denticola</it>. For all bacteria, the reaction was performed in 25 &#956;l reaction volumes using MegaMix 2MM-5 (Microzone Limited, West Sussex, UK) according to the manufacturer's instructions. The primer and target sequences used are shown in Table <tblr tid="T1">1</tblr>. The mixture contained 7 pmol of each primer, 3.8 mM MgCl<sub>2 </sub>and 2 &#956;l of DNA suspension. The thermocycler profile was as follows: an initial denaturation at 95&#176; C for 5 min; 35 cycles consisting of 50&#176;C for 1 min, 68&#176; C for 3 min and 40 sec and 95&#176; C for 1 min. PCR products were analysed by electrophoresis on a 1.2 % agarose gel containing ethidium bromide (0.5 mg/ml). With reconstruction experiments this method showed a detection limit range of 10-50 cells/PCR.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Reconstruction experiments: specificity and sensitivity of the method</p>
            </st>
            <p>A reconstruction experiment confirmed the PCR real time selectivity in the DNA extracts of three different suspensions: (i) <it>Aa </it>652, (ii) <it>Aa </it>JP2 and (iii) a mixture of the two genotypes. Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr> shows melting curves and the 1% agarose gel electrophoresis results of PCR real time products. In our study, with reconstruction and with clinical samples, we demonstrated melting temperatures of 76 &#177; 2 &#176;C in the JP2 positive samples, and 82 &#177; 2 &#176;C in the 652 positive samples; a double melting peak was obtained with both genotype mixtures tested (Figure <figr fid="F3">3</figr>). The 6 &#176;C difference in T<sub>m</sub>s allows an easier differentiation of two genotype profiles; no cross-reaction in T<sub>m</sub>s peaks was detected with strains 652 and JP2, indicating the good selectivity of the method. Only one size band for each genotype was verified and confirmed in agarose gel electrophoresis, respectively 696 bp for 652 and 192 bp for the JP2 strain (Figure <figr fid="F2">2</figr>); this suggests a total absence of non-specific products. Real-time PCR, as evaluated here, has been shown to have a detection limit of 40 <it>Aa </it>652 or JP2 cells/PCR (100 cells/ml). The wide linear range (10<sup>7</sup>-10<sup>2</sup>cells obtained for two genotypes) as illustrated in Figure .<figr fid="F4">4</figr>, indicates the efficiency of this real time PCR. Standard curves showed a similar slope and a good correlation regression coefficient R2 of 0.98&#8211;0.97 <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>, (Figure <figr fid="F4">4</figr>). In these experiments negative control contained DNA saliva extracts recovered from a non-diseased patient with PCR/negative culture for <it>Aa</it>, the total DNA amount of these samples was about 50 &#956;g/&#956;l. C lanes/curves do not contain aspecific products from previous interaction with human or non-specific bacterial genomic DNA as shown in Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>. The DNA sequencing results of the PCR amplicons were a perfect match, with Blast program analysis <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>, for the 652 genotype (Gen Bank accession n. S68133) or the JP2 genotype (Gen Bank accession n. X16829).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Real time PCR melting curve and agarose gel electrophoresis results obtained from saliva reconstruction samples containing different <it>Actinobacillus actinomycetemcomitans </it>genotypes</p>
               </caption>
               <text>
                  <p><b>Real time PCR melting curve and agarose gel electrophoresis results obtained from saliva reconstruction samples containing different <it>Actinobacillus actinomycetemcomitans </it>genotypes</b>. Curves 1&#8211;2: using a suspension containing the 652 or JP2 <it>Aa </it>genotype, the difference in T<sub>m</sub>s melting peaks was 6&#176;C between the two clones. The presence of a single 696 bp band for 652 and 192 bp for the JP2 strain in 1% agarose electrophoresis gel (Metaphor, BMA, Rockland ME USA) suggests a total absence of non-specific products, gel bands 1&#8211;2. Melting peak at 73&#176;C in negative control and the small band in the control samples "C" are primer dimer products.</p>
               </text>
               <graphic file="1471-2334-6-98-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Real time PCR melting curve and agarose gel electrophoresis results obtained using a suspension containing a mixture of two genotypes:</p>
               </caption>
               <text>
                  <p><b>Real time PCR melting curve and agarose gel electrophoresis results obtained using a suspension containing a mixture of two genotypes: </b>a single curve is obtained with two distinct T<sub>m</sub>s' peaks which confirm good system selectivity. Melting peak at 73&#176;C in negative control and the small band in the control samples "C" are primer dimer products.</p>
               </text>
               <graphic file="1471-2334-6-98-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Quantitative standard curves</p>
               </caption>
               <text>
                  <p><b>Quantitative standard curves</b>. Linear regressions obtained by real time PCR using a LightCycler instrument with SYBR Green I protocol of serially diluted suspensions for JP2 or 652 <it>Actinobacillus actinomycetemcomitans </it>genotypes (10<sup>7</sup>-10<sup>2 </sup>cells/ml). Threshold cycle (CT) value is directly related to the amount of PCR product and therefore related to the initial amount of target DNA present in the PCR reaction. CT (threshold cycle) represent the fractional PCR cycle number at which the fluorescence signal exceeds background fluorescence [40].</p>
               </text>
               <graphic file="1471-2334-6-98-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Results with clinical samples</p>
            </st>
            <p>We analyzed plaque and saliva samples collected from 81 patients following the protocols just described. In comparison with the cultural procedure, real time resulted as being a little more sensitive (1 saliva and 2 paper point samples were positive only with molecular methods), while real time and conventional PCR were in accordance. All negative samples with the real time PCR procedure also resulted negative with cultural and conventional PCR methods too. Only one subject in the non-diseased group (26 in total) resulted 652 <it>Aa </it>genotype-positive for the periodontal pocket specimen, with 10<sup>3 </sup>cells/ml bacteria in the paper point suspension and negative in the saliva sample. Table <tblr tid="T2">2</tblr> shows that 9 out of 55 diseased patients (16.3%) were infected with <it>Aa </it>and the disease severity was associated with a high bacteria title and/or leukotoxic genotype presence. In accordance with scientific data, we only identified the leukotoxic clone (JP2) in patients with severe forms of periodontitis <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. However, whenever a similar degree of clinical infection was present, and only the leukotoxic 652 genotype was identified, high bacteria titles were present (about &#8805; 10<sup>4 </sup>cells/ml in the paper point suspension). Two patients, with aggressive periodontitis, showed bacteria in saliva samples too; one was found positive for the 652 strain and the other for JP2, the same genotypes were detected respectively in periodontal pockets.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Real Time PCR results (title and genotype) in comparison with cultural and conventional PCR methods using saliva and subgingival plaque from 10 Sardinian subjects out of 81, positive for <it>A. actinomycetemcomitans</it>.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>Patient</p>
                     </c>
                     <c ca="left">
                        <p>Disease type</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Subgingival plaque</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Saliva</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p><it>Aa </it>Real time PCR [cells/ml paper point]</p>
                     </c>
                     <c ca="left">
                        <p>Culture for <it>Aa</it></p>
                     </c>
                     <c ca="left">
                        <p>Conventional PCR (for 4 periodontal pathogens)</p>
                     </c>
                     <c ca="left">
                        <p>Real time PCR <it>Aa </it>cells/ml</p>
                     </c>
                     <c ca="center">
                        <p>Aa Culture CFU/ml <it>vs </it>Conventional PCR (Aa 16S rRNA only)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C1</p>
                     </c>
                     <c ca="left">
                        <p>aggressive periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>1,9*10<sup>4 </sup>(652)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>3,0*10<sup>2 </sup>(652)</p>
                     </c>
                     <c ca="center">
                        <p>1,5*10<sup>1</sup>/pos</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C2</p>
                     </c>
                     <c ca="left">
                        <p>aggressive periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>4,0*10<sup>3 </sup>(JP2)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa, Pg</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1,3*10<sup>2 </sup>(JP2)</p>
                     </c>
                     <c ca="center">
                        <p>neg/pos</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C4</p>
                     </c>
                     <c ca="left">
                        <p>gingivitis</p>
                     </c>
                     <c ca="left">
                        <p>3,6*10<sup>3 </sup>(652)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p><it>Aa</it>,</p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C5</p>
                     </c>
                     <c ca="left">
                        <p>chronic periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>6,4*10<sup>3 </sup>(JP2)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa,Tf</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C6</p>
                     </c>
                     <c ca="left">
                        <p>chronic periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>1,9*10<sup>3 </sup>(JP2)</p>
                     </c>
                     <c ca="left">
                        <p>neg</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa,Tf</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C7</p>
                     </c>
                     <c ca="left">
                        <p>aggressive periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>2,8*10<sup>4 </sup>(JP2)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa,Pi,Tf</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C8</p>
                     </c>
                     <c ca="left">
                        <p>aggressive periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>4,4*10<sup>4 </sup>(JP2)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p><it>Aa</it>,</p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C25</p>
                     </c>
                     <c ca="left">
                        <p>aggressive periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>2,0*10<sup>3 </sup>(JP2)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p><it>Aa</it>,</p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C75</p>
                     </c>
                     <c ca="left">
                        <p>aggressive periodontitis</p>
                     </c>
                     <c ca="left">
                        <p>3,0 *10<sup>4 </sup>(652)</p>
                     </c>
                     <c ca="left">
                        <p>posit</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa, Pg, Pi,Tf</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C80</p>
                     </c>
                     <c ca="left">
                        <p>no disease</p>
                     </c>
                     <c ca="left">
                        <p>1,0*10<sup>3 </sup>(652)</p>
                     </c>
                     <c ca="left">
                        <p>neg</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aa, Pg, Pi,Tf</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Nd</p>
                     </c>
                     <c ca="center">
                        <p>neg/neg</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Legend:</p>
                  <p><it>Aa = A. actinomycetemcomitans, Pg = P. gingivalis, Pi = P. intermedia, Tf = T. forsythensis</it>.</p>
                  <p>Nd = non-detectable (&lt;10<sup>2 </sup>cells/ml)</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Subgingival distribution of different periodontal bacteria</p>
            </st>
            <p>Five periodontopathic bacteria: <it>A. actinomycemcomitans P. gingivalis, P. intermedia, T. forsytensis </it>and <it>T. denticola </it>were detected by a conventional PCR method from the subgingival plaque of all 81 patients. No periodontopathogenic bacterial DNA was observed in 39 of the samples (51%). The percentage of PCR positive samples was: <it>Aa </it>12.2%, <it>Pg </it>14.8%, <it>Pi </it>22%, <it>Tf </it>(the most representative bacteria in these samples) 40.8% and <it>Td </it>8.7 %. Six specimens resulting positive for <it>Aa</it>, (C2, C5, C6, C7, C75, C80) were associated with at least another periodontal bacteria. The principal pathogen was <it>T. forsythensis </it>present in 50% of the <it>Aa </it>positive samples. Sample C80, isolated in a non-diseased patient (2 mm subgingival pocket), contained all 4 tested pathogens (Table <tblr tid="T2">2</tblr>). In the PCR results four samples showed <it>Aa </it>DNA only (samples C1, C4, C8, C25) and these results were in accordance with the PCR real time and cultural result s(Table <tblr tid="T2">2</tblr>).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Periodontitis is an inflammatory disease caused by different species of anaerobic bacteria and is the most prevalent human disease; in addition a growing number of studies indicate that severe chronic forms of this disease are not only localized infections, but may also increase of the risk of various systemic conditions such as cardiovascular disease <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B42">42</abbr></abbrgrp>.</p>
         <p>The multi-factoriality of this infection is due to a complex bacteria population with high dynamicity and adaptability; consequently, treating periodontitis is difficult since the elimination of this pathogenic bacteria, once established in periodontal pockets, may not be possible, even with repetitive treatments. Moreover costs related to maintaining and replacing restoration work like fillings and crowns and those of periodontal treatment are high and similar problems occur with dental implants.</p>
         <p>For these reasons in periodontal disease prevention, diagnostic methods able to evaluate the virulence factors of periodontal bacteria are important, particularly in subjects without clinical symptoms but infected with these pathogens; for example patient C80 in our study.</p>
         <p>81 patients (diseased and non diseased) showed a sub-gingival distribution of periodontal bacteria in accordance with published data <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. In fact, at least 1 member of the red complex bacteria (<it>Pg</it>, <it>Tf, Td</it>) 47.2% or orange complex (Pi) 25.9% was found in the majority of diseased patients; ten subjects (0.12%) contained <it>A. actinomicetemcomitans </it>in the periodontal pocket and two of these also in saliva <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>.</p>
         <p>Different studies have considered <it>Aa </it>as an important etiological microorganism involved in aggressive periodontitis <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B35">35</abbr><abbr bid="B41">41</abbr><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr></abbrgrp> and it has been shown that a high-leukotoxin-producing strain of <it>Aa </it>is mainly found among individuals with severe forms of periodontitis <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B41">41</abbr></abbrgrp>. Different authors have recently described PCR real time methods for <it>Aa </it>quantization <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B34">34</abbr><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>, but with current molecular methods it is not possible to obtain simultaneous bacterial quantization and genotypization.</p>
         <p>We have described a fast molecular procedure (2 hours) with good sensitivity and specificity, able to quantify and differentiate strains 652 and JP2 of <it>Aa </it>simultaneously. We analyzed subgingival plaque and saliva samples collected from subjects with different periodontal status and the results showed that in comparison with recent bibliographic data obtained in other geographical regions, the same differences in <it>Aa </it>distribution were also evaluated in Sardinian people <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B49">49</abbr></abbrgrp>. In fact, within the non-diseased patients (n= 26, 3.8%), only one individual resulted <it>Aa </it>positive with all the three methods used; 24 chronic and 8 subjects with aggressive periodontitis (33%) showed the bacteria in oral clinical samples. Genotype JP2 was the most represented in all periodontal patients whose age was >29 mean = 47. None of the adolescent subjects examined in this study (n= 5, age 10 to 15 years) showed periodontal disease.</p>
         <p>In comparison with the other periodontal pathogens tested, 4 samples were positive only for Aa; this could mean that in these samples disease severity may depend on the number and genotype of this microorganism. However when other periodontal pathogens were present, high numbers or high leukotoxic <it>Aa </it>genotype were mostly correlated with severe forms of periodontitis. (chronic or aggressive). The presence of this strain in saliva too, (two cases in these patients), has been described by other authors <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>; Our results shows that the same genotype is present in saliva and in periodontal pockets, indicating a possible and continuous bacteria replacement in saliva from an important reservoir which is the periodontal district. Moreover, real time PCR quantification of saliva could explain its role as a means of bacterial transmission in patients with a high infectious dose of <it>Aa</it>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Experimental results suggest the importance of obtaining both bacterial titre and genotype identification to give the correct microbiological diagnosis in periodontal infections. Further investigations and sample enlargements could give us more answers about the correlation between bacterial status in the oral cavity and disease severity and progression. The presented method/approach is suitable for a rapid and complete laboratory diagnosis of <it>Aa </it>infection.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p><it>Aa</it>, <it>Actinobacillus actinomycetemcomitans; </it>T<sub>m</sub>, melting temperature; CTAB, Hexadecyl trimetylammonium bromide</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare/s that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p><b>GO</b>: designed the study, primary author of the manuscript. <b>MFM, MC</b>: examined and selected the patients, critical appraisal and editing of the manuscript. <b>MLC, DI</b>: maintained the isolates, the strains, prepared cultures and performed the real time PCR experiments. <b>VP, MB</b>: critical analysis of the manuscript, editing and final presentation. <b>EP</b>: assisted in writing the paper and critical analysis of the manuscript. <b>CM</b>: analysed the experimental data and critical analysis of the manuscript. All authors read and approved this manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The role of <it>Actinobacillus actinomycetemcomitans </it>in the pathogenesis of periodontal disease</p>
            </title>
            <aug>
               <au>
                  <snm>Meyer</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Fives-Taylor</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>Trends Microbiol</source>
            <pubdate>1997</pubdate>
            <volume>15</volume>
            <fpage>224</fpage>
            <lpage>228</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0966-842X(97)01055-X</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Heterogeneity of <it>Actinobacillus actinomycetemcomitans </it>strains in various human infections and relationships between serotype, genotype, and antimicrobial susceptibility</p>
            </title>
            <aug>
               <au>
                  <snm>Paju</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Carlson</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Jousimies-Somer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Asikainen</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>38</volume>
            <fpage>79</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">86024</pubid>
                  <pubid idtype="pmpid" link="fulltext">10618067</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p><it>Actinobacillus actinomycetemcomitans </it>endocarditis</p>
            </title>
            <aug>
               <au>
                  <snm>Paturel</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Casalta</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Habib</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Nezri</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Raoult</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Clin Microbiol Infect</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <fpage>98</fpage>
            <lpage>118</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1469-0691.2004.00794.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14759235</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Diagnosis of <it>Actinobacillus actinomycetemcomitans </it>infective endocarditis after steadily negative blood cultures</p>
            </title>
            <aug>
               <au>
                  <snm>Rottman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hanau-Bercot</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Fiszbin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Raskine</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gravisse</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Caulin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sanson-Le Pors</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>J Infect</source>
            <pubdate>2002</pubdate>
            <volume>44</volume>
            <fpage>208</fpage>
            <lpage>210</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/jinf.2002.0967</pubid>
                  <pubid idtype="pmpid" link="fulltext">12099759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Development of a classification system for periodontal diseases and conditions</p>
            </title>
            <aug>
               <au>
                  <snm>Armitage</snm>
                  <fnm>GC</fnm>
               </au>
            </aug>
            <source>Ann Periodontol</source>
            <pubdate>1999</pubdate>
            <volume>4</volume>
            <fpage>1</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1902/annals.1999.4.1.1</pubid>
                  <pubid idtype="pmpid">10863370</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The distribution and transmission of <it>Actinobacillus actinomycetemcomitans </it>in families with localized juvenile periodontitis</p>
            </title>
            <aug>
               <au>
                  <snm>Tinoco</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Sivakumar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Preus</snm>
                  <fnm>HR</fnm>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>1998</pubdate>
            <volume>25</volume>
            <fpage>99</fpage>
            <lpage>105</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.1998.tb02415.x</pubid>
                  <pubid idtype="pmpid">9495608</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p><it>Actinobacillus actinomycetemcomitans </it>in human periodontal disease</p>
            </title>
            <aug>
               <au>
                  <snm>Zambon</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>1985</pubdate>
            <volume>12</volume>
            <fpage>1</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.1985.tb01348.x</pubid>
                  <pubid idtype="pmpid">3882766</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Secretion of RTX leukotoxin by <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kachlany</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Fine</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Figurski</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2000</pubdate>
            <volume>68</volume>
            <fpage>6094</fpage>
            <lpage>6100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">97685</pubid>
                  <pubid idtype="pmpid" link="fulltext">11035711</pubid>
                  <pubid idtype="doi">10.1128/IAI.68.11.6094-6100.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Purification of secreted leukotoxin (LtxA) from <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kachlany</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Fine</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Figurski</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>Protein Expr Purif</source>
            <pubdate>2002</pubdate>
            <volume>25</volume>
            <fpage>465</fpage>
            <lpage>467</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1046-5928(02)00037-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">12182827</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Analysis of the <it>Actinobacillus actinomycetemcomitans </it>leukotoxin gene. Delineation of unique features and comparison to homologous toxins</p>
            </title>
            <aug>
               <au>
                  <snm>Lally</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Golub</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Kieba</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Taichman</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>Rosenbloom</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Rosenbloom</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Demuth</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1989</pubdate>
            <volume>264</volume>
            <fpage>15451</fpage>
            <lpage>15456</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">2670940</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Conformational studies of <it>Actinobacillus actinomycetemcomitans </it>leukotoxin: partial denaturation enhances toxicity</p>
            </title>
            <aug>
               <au>
                  <snm>Lear</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Karakelian</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Furblur</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Lally</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>2000</pubdate>
            <volume>1476</volume>
            <fpage>350</fpage>
            <lpage>362</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10669799</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Leukotoxins of gram-negative bacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Narayanan</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Nagaraja</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Chengappa</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>GC</fnm>
               </au>
            </aug>
            <source>Vet Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>84</volume>
            <fpage>337</fpage>
            <lpage>356</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1135(01)00467-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">11750142</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Tumor necrosis factor alpha enhances <it>Actinobacillus actinomycetemcomitans </it>leukotoxin-induced HL-60 cell apoptosis by stimulating lymphocyte function-associated antigen 1 expression</p>
            </title>
            <aug>
               <au>
                  <snm>Yamaguchi</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kubo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Masuhiro</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Lally</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Koga</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hanazawa</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2004</pubdate>
            <volume>72</volume>
            <fpage>269</fpage>
            <lpage>276</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">343981</pubid>
                  <pubid idtype="pmpid" link="fulltext">14688105</pubid>
                  <pubid idtype="doi">10.1128/IAI.72.1.269-276.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Regulation of <it>Actinobacillus actinomycetemcomitans </it>leukotoxin expression: analysis of the promoter regions of leukotoxic and minimally leukotoxic strains</p>
            </title>
            <aug>
               <au>
                  <snm>Brogan</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Lally</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Poulsen</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kilian</snm>
                  <fnm>MD</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1994</pubdate>
            <volume>62</volume>
            <fpage>501</fpage>
            <lpage>508</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">186135</pubid>
                  <pubid idtype="pmpid">8300209</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Evidence for the role of highly leukotoxic <it>Actinobacillus actinomycetemcomitans </it>in the pathogenesis of localized juvenile and other forms of early-onset periodontitis</p>
            </title>
            <aug>
               <au>
                  <snm>Haraszthy</snm>
                  <fnm>VI</fnm>
               </au>
               <au>
                  <snm>Hariharan</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tinoco</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Cortelli</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Lally</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Zambon</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>J Periodontol</source>
            <pubdate>2000</pubdate>
            <volume>71</volume>
            <fpage>912</fpage>
            <lpage>922</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1902/jop.2000.71.6.912</pubid>
                  <pubid idtype="pmpid">10914794</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Detection of a highly toxic clone of <it>Actinobacillus actinomycetemcomitans </it>(JP2) in a Moroccan immigrant family with multiple cases of localized aggressive periodontitis</p>
            </title>
            <aug>
               <au>
                  <snm>Haubek</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Westergaard</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Int J Paediatr Dent</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <fpage>41</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-263X.2004.00518.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14706027</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Differential regulation of the leukotoxin operon in highly leukotoxic and minimally leukotoxic strains of <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hritz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Demuth</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1996</pubdate>
            <volume>64</volume>
            <fpage>2724</fpage>
            <lpage>2729</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">174132</pubid>
                  <pubid idtype="pmpid" link="fulltext">8698501</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>cis Elements and trans factors are both important in strain-specific regulation of the leukotoxin gene in <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kolodrubetz</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Spitznagel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Phillips</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kraig</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1996</pubdate>
            <volume>64</volume>
            <fpage>3451</fpage>
            <lpage>3460</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">174248</pubid>
                  <pubid idtype="pmpid" link="fulltext">8751884</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Improved selective culture media for <it>Actinobacillus actinomycetemcomitans </it>and <it>Haemophilus aphrophilus</it></p>
            </title>
            <aug>
               <au>
                  <snm>Holm</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rabe</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kalfas</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Edwarsson</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1987</pubdate>
            <volume>25</volume>
            <fpage>1985</fpage>
            <lpage>1988</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">269382</pubid>
                  <pubid idtype="pmpid">3667919</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Selective medium for isolation of <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Slots</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1982</pubdate>
            <volume>15</volume>
            <fpage>606</fpage>
            <lpage>609</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">272154</pubid>
                  <pubid idtype="pmpid">7068837</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Enumeration of <it>Porphyromonas gingivalis</it>, <it>Prevotella intermedia </it>and <it>Actinobacillus actinomycetemcomitans </it>in subgingival plaque samples by a quantitative-competitive PCR method</p>
            </title>
            <aug>
               <au>
                  <snm>Doungudomdacha</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rawlinson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Douglas</snm>
                  <fnm>CW</fnm>
               </au>
            </aug>
            <source>J Med Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>49</volume>
            <fpage>861</fpage>
            <lpage>867</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11023183</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Rapid DNA probe method for detection of <it>Porphyromonas gingivalis and Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Komiya</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nakagawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Saito</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Takahashi</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yamada</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Okuda</snm>
                  <fnm>KA</fnm>
               </au>
            </aug>
            <source>J Periodontol</source>
            <pubdate>2000</pubdate>
            <volume>71</volume>
            <fpage>760</fpage>
            <lpage>767</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1902/jop.2000.71.5.760</pubid>
                  <pubid idtype="pmpid">10872957</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Quantitative detection of parodontal pathogens using real-time polymerase chain reaction with TaqMan probes</p>
            </title>
            <aug>
               <au>
                  <snm>Kuboniwa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Amano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kimura</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Sekine</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Okahashi</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Iida</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Shizukuishi</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Oral Microbiol Immunol</source>
            <pubdate>2004</pubdate>
            <volume>19</volume>
            <fpage>168</fpage>
            <lpage>176</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.0902-0055.2004.00135.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15107068</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Quantitative real-time polymerase chain reaction versus culture: a comparison between two methods for the detection and quantification of <it>Actinobacillus actinomycetemcomitans</it>, <it>Porphyromonas gingivalis </it>and <it>Tannerella forsythensis </it>in subgingival plaque samples</p>
            </title>
            <aug>
               <au>
                  <snm>Lau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sanz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Herrera</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Morillo</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>2004</pubdate>
            <volume>31</volume>
            <fpage>1061</fpage>
            <lpage>1069</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.2004.00616.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15560806</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Detection and strain identification of <it>Actinobacillus actinomycetemcomitans </it>by nested PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Leys</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Griffen</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Strong</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Fuerst</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1994</pubdate>
            <volume>32</volume>
            <fpage>1288</fpage>
            <lpage>1294</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">263671</pubid>
                  <pubid idtype="pmpid">8051258</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Quantitative real-time PCR using TaqMan and SYBR Green for <it>Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia</it>, tetQ gene and total bacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Maeda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Fujimoto</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Haruki</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Maeda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kokeguchi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Petelin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Arai</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tanimoto</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Takashiba</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>FEMS Immunol Med Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>39</volume>
            <fpage>81</fpage>
            <lpage>86</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0928-8244(03)00224-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">14557000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Quantitative real-time PCR based on single copy gene sequence for detection of <it>Actinobacillus actinomycetemcomitans </it>and <it>Porphyromonas gingivalis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Morillo</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Lau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sanz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Herrera</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Periodontal Res</source>
            <pubdate>2003</pubdate>
            <volume>38</volume>
            <fpage>518</fpage>
            <lpage>524</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1600-0765.2003.00684.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12941077</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Quantitative real-time polymerase chain reaction based on single copy gene sequence for detection of parodontal pathogens</p>
            </title>
            <aug>
               <au>
                  <snm>Morillo</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Lau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sanz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Herrera</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>2004</pubdate>
            <volume>31</volume>
            <fpage>1054</fpage>
            <lpage>1060</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051x.2004.00608.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15560805</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Improved PCR for detection of the highly leukotoxic JP2 clone of <it>Actinobacillus actinomycetemcomitans </it>in subgingival plaque samples</p>
            </title>
            <aug>
               <au>
                  <snm>Poulsen</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ennibi</snm>
                  <fnm>OK</fnm>
               </au>
               <au>
                  <snm>Haubek</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>41</volume>
            <fpage>4829</fpage>
            <lpage>4932</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">254341</pubid>
                  <pubid idtype="pmpid" link="fulltext">14532234</pubid>
                  <pubid idtype="doi">10.1128/JCM.41.10.4829-4832.2003</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Endpoint quantitative PCR assays for <it>Bacteroides forsythus, Porphyromonas gingivalis</it>, and <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Rudney</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pan</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>J Periodontal Res</source>
            <pubdate>2003</pubdate>
            <volume>38</volume>
            <fpage>465</fpage>
            <lpage>470</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1600-0765.2003.00670.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12941069</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p><it>Actinobacillus actinomycetemcomitans </it>genetic heterogeneity: amplification of JP2-like ltx promoter pattern correlated with specific arbitrarily primed polymerase chain reaction (AP-PCR) genotypes from human but not marmoset Brazilian isolates</p>
            </title>
            <aug>
               <au>
                  <snm>Saddi-Ortega</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Carvalho</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Cisalpino</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Moreira</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>J Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>48</volume>
            <fpage>602</fpage>
            <lpage>610</lpage>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Methods of detection of <it>Actinobacillus actinomycetemcomitans</it>, <it>Porphyromonas gingivalis </it>and <it>Tannerella forsythensis </it>in parodontal microbiology, with special emphasis on advanced molecular techniques: a review</p>
            </title>
            <aug>
               <au>
                  <snm>Sanz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Herrera</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Morillo</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>2004</pubdate>
            <volume>31</volume>
            <fpage>1034</fpage>
            <lpage>1047</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.2004.00609.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15560803</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Identification of <it>Actinobacillus actinomycetemcomitans </it>serotypes by multiplex PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nakano</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yoshida</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ikeda</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Koga</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2001</pubdate>
            <volume>39</volume>
            <fpage>2002</fpage>
            <lpage>2005</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">88070</pubid>
                  <pubid idtype="pmpid" link="fulltext">11326035</pubid>
                  <pubid idtype="doi">10.1128/JCM.39.5.2002-2005.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Development of a 5' fluorogenic nuclease-based real-time PCR assay for quantitative detection of <it>Actinobacillus actinomycetemcomitans </it>and <it>Porphyromonas gingivalis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Yoshida</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nakano</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Oho</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kawada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Koga</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>41</volume>
            <fpage>863</fpage>
            <lpage>866</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">149717</pubid>
                  <pubid idtype="pmpid" link="fulltext">12574302</pubid>
                  <pubid idtype="doi">10.1128/JCM.41.2.863-866.2003</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The periodontal disease classification system of the American Academy of Periodontology -an update</p>
            </title>
            <aug>
               <au>
                  <snm>Wiebe</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Putnins</snm>
                  <fnm>EE</fnm>
               </au>
            </aug>
            <source>J Can Dent Assoc</source>
            <pubdate>2000</pubdate>
            <volume>66</volume>
            <fpage>594</fpage>
            <lpage>597</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11253351</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Sampling of periodontal pathogens by paper points: evaluation of basic parameter</p>
            </title>
            <aug>
               <au>
                  <snm>Hartroth</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Seyfahrt</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Conrads</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Oral Microbiol Immunol</source>
            <pubdate>1999</pubdate>
            <volume>14</volume>
            <fpage>326</fpage>
            <lpage>330</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1399-302X.1999.140510.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10551161</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Thermodynamic parameters for DNA sequences with dangling ends</p>
            </title>
            <aug>
               <au>
                  <snm>Bommarito</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Peyret</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Santa Lucia</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2000</pubdate>
            <volume>28</volume>
            <fpage>1929</fpage>
            <lpage>1934</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">103285</pubid>
                  <pubid idtype="pmpid" link="fulltext">10756193</pubid>
                  <pubid idtype="doi">10.1093/nar/28.9.1929</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Direct sequencing of long polymerase chain reaction fragments</p>
            </title>
            <aug>
               <au>
                  <snm>Iannelli</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Giunti</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pozzi</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Mol Biotechnol</source>
            <pubdate>1998</pubdate>
            <volume>2</volume>
            <fpage>183</fpage>
            <lpage>5</lpage>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Quantification on the LightCycler</p>
            </title>
            <aug>
               <au>
                  <snm>Rasmussen</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Rapid Cycle Real-Time PCR Methods and Applications</source>
            <editor>Meuer S, Wittwer C, Nakagawara K</editor>
            <pubdate>1998</pubdate>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Rapid Cycle Real Time PCR: Methods and Applications</p>
            </title>
            <aug>
               <au>
                  <snm>Wittwer</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Rapid Cycle Real-Time PCR Methods and Applications</source>
            <editor>Meuer S, Wittwer C, Nakagawara K</editor>
            <pubdate>2001</pubdate>
            <fpage>1</fpage>
            <lpage>8</lpage>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Detection of highly and minimally leukotoxic <it>Actinobacillus actinomycetemcomitans </it>strains in patients with parodontal disease</p>
            </title>
            <aug>
               <au>
                  <snm>Cortelli</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Jorge</snm>
                  <fnm>AO</fnm>
               </au>
               <au>
                  <snm>Cortelli</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Jordan</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Haraszthy</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Pesqui Odontol Bras</source>
            <pubdate>2003</pubdate>
            <volume>17</volume>
            <fpage>183</fpage>
            <lpage>188</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1590/S1517-74912003000200016</pubid>
                  <pubid idtype="pmpid">14569364</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Systemic effects of periodontitis epidemiology of periodontal disease and cardiovascular disease</p>
            </title>
            <aug>
               <au>
                  <snm>Beck</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Offenbacher</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Periodontol</source>
            <pubdate>2005</pubdate>
            <volume>76</volume>
            <fpage>2089</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1902/jop.2005.76.11-S.2089</pubid>
                  <pubid idtype="pmpid">16277581</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Microbial complexes in subgingival plaque</p>
            </title>
            <aug>
               <au>
                  <snm>Socransky</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Haffajee</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Cugini</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kent</snm>
                  <fnm>RL</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>1998</pubdate>
            <volume>25</volume>
            <fpage>134</fpage>
            <lpage>44</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.1998.tb02419.x</pubid>
                  <pubid idtype="pmpid">9495612</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Distribution of 10 periodontal bacteria in saliva samples from Japanese children and their mothers</p>
            </title>
            <aug>
               <au>
                  <snm>Tamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakano</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hayashibara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nomura</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Fujita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Shintani</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ooshima</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Arch Oral Biol</source>
            <pubdate>2005</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16269128</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>In vivo induced antigenic determinants of <it>Actinobacillus actinomycetemcomitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Cao</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Progulske-Fox</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hillman</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Handfield</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>2004</pubdate>
            <volume>237</volume>
            <fpage>97</fpage>
            <lpage>103</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1574-6968.2004.tb09683.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15268943</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Relationship of <it>Actinobacillus actinomycetemcomitans </it>serotype b to aggressive periodontitis: frequency in pure cultured isolates</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>HW</fnm>
               </au>
               <au>
                  <snm>Asikainen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dogan</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Suda</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>CH</fnm>
               </au>
            </aug>
            <source>J Periodontol</source>
            <pubdate>2004</pubdate>
            <volume>75</volume>
            <fpage>592</fpage>
            <lpage>599</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1902/jop.2004.75.4.592</pubid>
                  <pubid idtype="pmpid">15152825</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Characterization of <it>Actinobacillus actinomycetemcomitans </it>isolated from young Chinese aggressive periodontitis patients</p>
            </title>
            <aug>
               <au>
                  <snm>Leung</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Ngai</snm>
                  <fnm>VK</fnm>
               </au>
               <au>
                  <snm>Yau</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Cheung</snm>
                  <fnm>BP</fnm>
               </au>
               <au>
                  <snm>Tsang</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Corbet</snm>
                  <fnm>EF</fnm>
               </au>
            </aug>
            <source>J Parodontal Res</source>
            <pubdate>2005</pubdate>
            <volume>40</volume>
            <fpage>258</fpage>
            <lpage>268</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1600-0765.2005.00805.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Quantitative detection of periodontopathogens by real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Nonnenmacher</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dalpke</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mutters</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Heeg</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Microbiol Methods</source>
            <pubdate>2004</pubdate>
            <volume>59</volume>
            <fpage>117</fpage>
            <lpage>125</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.mimet.2004.06.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">15325758</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Prevalence of periodontal pathogens in Brazilians with aggressive or chronic periodontitis</p>
            </title>
            <aug>
               <au>
                  <snm>Cortelli</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Cortelli</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Jordan</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Zambon</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Journal Of Clinical Periodontology</source>
            <pubdate>2005</pubdate>
            <volume>32</volume>
            <fpage>860</fpage>
            <lpage>866</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.2005.00777.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15998269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Program "HYTHER"</p>
            </title>
            <url>http://ozone.chem.wayne.edu/</url>
         </bibl>
         <bibl id="B51">
            <title>
               <p>BLAST</p>
            </title>
            <url>http://www.ncbi.nlm.nih.gov/BLAST/</url>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2334/6/98/prepub</url>
         </p>
      </sec>
   </bm>
</art>
