<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2334-5-78</ui>
   <ji>1471-2334</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>GB virus-C &#8211; a virus without a disease: We cannot give it chronic fatigue syndrome</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Jones</snm>
               <mi>F</mi>
               <fnm>James</fnm>
               <insr iid="I1"/>
               <email>jaj9@cdc.gov</email>
            </au>
            <au id="A2">
               <snm>Kulkarni</snm>
               <mi>S</mi>
               <fnm>Prasad</fnm>
               <insr iid="I2"/>
               <email>pgk7@cdc.gov</email>
            </au>
            <au id="A3">
               <snm>Butera</snm>
               <mi>T</mi>
               <fnm>Salvatore</fnm>
               <insr iid="I2"/>
               <email>stb3@cdc.gov</email>
            </au>
            <au id="A4">
               <snm>Reeves</snm>
               <mi>C</mi>
               <fnm>William</fnm>
               <insr iid="I1"/>
               <email>wcr1@cdc.gov</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Viral Exanthems and Herpesvirus Branch, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, 1600 Clifton Rd, mailstop A-15, Atlanta, Georgia, 30333, USA</p>
            </ins>
            <ins id="I2">
               <p>Laboratory Branch, Division of HIV/AIDS Prevention, Centers for Disease Control and Prevention, 1600 Clifton Rd, mailstop G-19, Atlanta, Georgia, 30333, USA</p>
            </ins>
         </insg>
         <source>BMC Infectious Diseases</source>
         <issn>1471-2334</issn>
         <pubdate>2005</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>78</fpage>
         <url>http://www.biomedcentral.com/1471-2334/5/78</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16191201</pubid>
               <pubid idtype="doi">10.1186/1471-2334-5-78</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>28</day>
               <month>6</month>
               <year>2005</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>28</day>
               <month>9</month>
               <year>2005</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>28</day>
               <month>9</month>
               <year>2005</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2005</year>
         <collab>Jones et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Chronic fatigue syndrome (CFS) is an illness in search of an infectious etiology. GB virus-C (GBV-C) virus is a flavivirus with cell tropism and host defense induction qualities compatible with a role in producing the syndrome. The GBV-C genome is detectable in 4% of the population and 12% of the population is seropositive. The present study evaluated the association between infection with GBV and CFS.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>We used a commercial EIA to detect antibodies against the GBV-C E2 protein and a quantitative real-time RT-PCR assay to detect active GBV-C infection. Sera were from a case control study of CFS in Atlanta, Georgia. The Fisher's exact two-tailed test was used for statistical analysis.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Two of 12 CFS patients and one of 21 controls were seropositive for prior GBV-C infection and one control had viral RNA detected, indicating active infection. The results are not statistically different.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>We found no evidence that active or past infection with GBV is associated with CFS.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Chronic fatigue syndrome (CFS) affects 400,000 to 900,000 adults in the United States <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. At least a quarter of those suffering from CFS are unemployed or receiving disability because of the illness; the average affected family forgoes $20,000 annually in lost earnings and wages (approximately half of the average United States household income); and, the annual value of lost productivity in the United States is approximately $9 billion <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Despite the public health burden imposed by CFS, diagnostic, treatment and prevention strategies have proven difficult to devise because the etiology, pathophysiology and risk factors of CFS remain unknown [reviewed in <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>].</p>
         <p>Because the symptoms resemble those of infectious diseases and because CFS may follow an acute infectious disease, a considerable body of work has attempted to identify persistent or reactivated infection in patients with this illness [reviewed in <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>]. These efforts have included analysis of seroprevalence, evaluation of viral RNA and DNA (i.e., latent/active infection), and most recently, molecular identification procedures for unique, previously uncharacterized pathogens <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. None of these reports have developed convincing evidence for a significant association between any infectious agent and CFS.</p>
         <p>However, negative, inconclusive, and conflicting case control studies do not mean that infectious etiologies for CFS should be dismissed. A recently discovered flavivirus, GB virus-C/HGV (GBV-C) <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>, has many properties that demanded a study assessing its possible association with CFS. GBV-C preferentially replicates in peripheral blood mononuclear cells (PBMC), primarily B and T lymphocytes, and in bone marrow <it>in vivo </it><abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Of note, some flaviviruses activate the classic complement pathway <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> and we have found a high prevalence of split products (C3a, C4a, and C5a) in patients with CFS compared to controls <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. We have also examined mononuclear cell populations for gene expression patterns and have found differences between patients and control subjects <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. GBV-C viremia may persist for several years following primary infection and serologically antibodies are generated against the envelope protein, E2 [reviewed in <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B18">18</abbr></abbrgrp>]. The antibodies are also long-lived and may protect against re-infection <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. GBV-C viremia and presence of antibodies are usually mutually exclusive, and only a small percentage of exposed individuals exhibit both viremia and anti-E2 antibody <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. As yet, no illness has been associated with GBV infection.</p>
         <p>Therefore, thinking that complement activation and altered mononuclear cell gene expression might reflect continued infection with this virus, we chose to evaluate banked serum specimens from subjects enrolled in a case control study for GBV-C RNA, an indication of persistent active infection that might be associated with CFS and for specific antibodies associated with clearance of a GBV-C infection (anti-E2) as an indicator of past infection with this virus.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <p>This study adhered to human experimentation guidelines of the U.S. Department of Health and Human Services and the Helsinki Declaration. The CDC Institutional Review Board approved study protocols. All participants were volunteers who gave informed consent.</p>
         <sec>
            <st>
               <p>Study subjects</p>
            </st>
            <p>Subjects and study design have been presented in detail elsewhere <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. In brief, 26 patients with CFS (23 women and 3 men) were recruited from a physician surveillance study in Atlanta <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Patients met the 1988 CFS research case definition <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> and had been ill for no more than 10 years. Two age-(&#177; 5 years), race-, and sex-matched nonfatigued control subjects were contacted by means of random-digit dialing in the Atlanta area. Subjects' clinical, seroepidemiologic <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>, and immunological characteristics have been reported <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. For the current pilot study, testable sera were available from 12 cases and 21 controls.</p>
         </sec>
         <sec>
            <st>
               <p>Laboratory procedures</p>
            </st>
            <sec>
               <st>
                  <p>Detection of GBV-C infection</p>
               </st>
               <p>Plasma samples were tested for antibodies against the GBV-C E2 envelope protein by a &#956;PLATE Anti-HGenv microtiter assay (Roche Diagnostics Corp., Indianapolis, Ind.). Furthermore, nucleic acids were extracted from 200 &#956;L of plasma by using the QIAamp Viral RNA Mini Kit (Qiagen Inc., Valencia, Calif.), as per the manufacturer's recommendations. A real-time quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) was developed to detect GBV-C and determine the GBV-C viral load. Five microliters of extracted nucleic acids were used in the qRT-PCR assay, performed in a final volume of 50 &#956;L using the Quantitect Probe RT-PCR kit (Qiagen). The primers used were: GBV-C 03.1-F &#8211; 5' GCACGGTCCACAGGTGTT 3' (nucleotides 226-243 of the sequence with GenBank accession number <ext-link ext-link-type="gen" ext-link-id="U44402">U44402</ext-link><abbrgrp><abbr bid="B14">14</abbr></abbrgrp> and GBV-C 03.2-R &#8211; 5' GTACGTGGGCGTCGTTTG 3' (nucleotides 313&#8211;330). The probe used had the sequence 5' CCGACGTCAGGCTCGTCGTTAAAC 3' (nucleotides 268&#8211;291), and was labeled with 6-carboxy-fluorescein (FAM) on the 5' end and a dark quencher on the 3' end. This combination of primers resulted in an amplicon of 105 base pairs (bp). Serial dilutions of <it>in vitro </it>transcribed RNA generated from a linearized plasmid encoding nucleotides 136&#8211;400 of the 5' UTR of GBV-C with GenBank accession number <ext-link ext-link-type="gen" ext-link-id="U44402">U44402</ext-link><abbrgrp><abbr bid="B14">14</abbr></abbrgrp> was used as a quantitative standard curve.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>Statistics</p>
            </st>
            <p>Based on the estimated prevalence of GBV-C (&lt; 4%) in healthy blood donors in the US <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, the available sample size of 12 CFS subjects and 21 controls should allow detection of 60 % positivity in viremia or positive serology at the 95% confidence level with a power of 80: with at least 50% of persons with CFS demonstrating viremia. These estimates are based on the assumption that if GBV-C infection is the primary cause CFS, the majority of CFS subjects would be positive in one of the assay systems. Results were analyzed using Fisher's exact test (2-tailed). Odds ratios were calculated from a Chi square table and confidence intervals defined using the Wald statistic.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <p>Two cases (16.7%) and 1 control (4.8%) were seropositive (2-tailed Fisher's exact test p = .54). Only one person (a control subject) had detectable GBV-C RNA. Although the odds ratio of this difference is 5.14, the confidence interval (CI 0.32&#8211;49.59) demonstrates the difference was statistically insignificant.</p>
         <p>This exploratory study did not identify significant differences in active or cleared GBV-C infections between individuals fulfilling a clinical definition of CFS or in control subjects. These data would not exclude GBV-C infection in small percentages (&lt;20%) of CFS patients.</p>
         <p>Since previous studies that used seropositivity or gene expression alone have failed to demonstrate an association between specific infections and CFS, we reasoned that a combined serological and virological approach would be more appropriate since only ongoing infection with GBV-C is associated with viremia. These results are consistent with values reported in a variety of population studies regarding the prevalence of GBV-C. Previous studies have addressed <it>Herpesviridae</it>, enteroviruses, retroviruses, hepatitis C, HTLV-II <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> and recently parvovirus <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and Borna virus <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, but no definitive causative links have been made. Thus, another attempt to link a majority of CFS cases with a specific infectious agent did not identify a specific association.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>CFS remains a clinically identifiable, but daunting, medical and psychological problem.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>JJ and SB conceived the study. JJ was responsible for specimen identification, evaluation of results and preparation of the manuscript. PK performed the antibody and PCR procedures and participated in the preparation of the manuscript. SB supervised the laboratory procedures and participated in the preparation of the manuscript. WR was responsible for the primary patient study and participated in the design and evaluation of the study, and participated in the preparation of the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>Elizabeth R. Unger, MD, PhD contributed the title of the manuscript.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>A community-based study of chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Jason</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Richman</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Rademaker</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>Jordan</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Plioplys</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>McCready</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Plioplys</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Arch Intern Med</source>
            <pubdate>1999</pubdate>
            <volume>159</volume>
            <fpage>2129</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archinte.159.18.2129</pubid>
                  <pubid idtype="pmpid" link="fulltext">10527290</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas</p>
            </title>
            <aug>
               <au>
                  <snm>Reyes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nisenbaum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hoaglin</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Emmons</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Randall</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Abbey</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Gantz</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Minden</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Arch Intern Med</source>
            <pubdate>2003</pubdate>
            <volume>163</volume>
            <fpage>1530</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archinte.163.13.1530</pubid>
                  <pubid idtype="pmpid" link="fulltext">12860574</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Functional status of persons with chronic fatigue syndrome in the Wichita population</p>
            </title>
            <aug>
               <au>
                  <snm>Solomon</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nisenbaum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Papanicolaou</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Health Qual Life Outcomes</source>
            <pubdate>2003</pubdate>
            <volume>1</volume>
            <fpage>48</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1477-7525-1-48</pubid>
                  <pubid idtype="pmpid" link="fulltext">14577835</pubid>
                  <pubid idtype="pmcid">239865</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>The economic impact of chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Reynolds</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Vernon</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Bouchery</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Cost Eff Resour Alloc</source>
            <pubdate>2004</pubdate>
            <volume>2</volume>
            <fpage>4</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1478-7547-2-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">15210053</pubid>
                  <pubid idtype="pmcid">449736</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Chronic fatigue syndrome: A review</p>
            </title>
            <aug>
               <au>
                  <snm>Afari</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Buchwald</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Am J Psychiatry</source>
            <pubdate>2003</pubdate>
            <volume>160</volume>
            <fpage>221</fpage>
            <lpage>236</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1176/appi.ajp.160.2.221</pubid>
                  <pubid idtype="pmpid" link="fulltext">12562565</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Seroepidemiology of chronic fatigue syndrome: A case control study</p>
            </title>
            <aug>
               <au>
                  <snm>Mawle</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Nisenbaum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Dobbins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Gary</snm>
                  <fnm>HE</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Steele</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Schmid</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>1995</pubdate>
            <volume>21</volume>
            <fpage>1386</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8749620</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Markers of viral infection in monozygotic twins discordant for chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Koelle</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Barcy</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Ashley</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Corey</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Zeh</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ashton</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Buchwald</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2002</pubdate>
            <volume>35</volume>
            <fpage>518</fpage>
            <lpage>25</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/341774</pubid>
                  <pubid idtype="pmpid" link="fulltext">12173124</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Viral serologies in patients with chronic fatigue and chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Buchwald</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ashley</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Pearlman</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kith</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Komaroff</snm>
                  <fnm>AL</fnm>
               </au>
            </aug>
            <source>J Med Virol</source>
            <pubdate>1996</pubdate>
            <volume>50</volume>
            <fpage>25</fpage>
            <lpage>30</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-9071(199609)50:1&lt;25::AID-JMV6>3.0.CO;2-V</pubid>
                  <pubid idtype="pmpid">8890037</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Analysis of 16S rRNA gene sequences and circulating cell-free DNA from plasma of chronic fatigue :syndrome and non-fatigued subjects</p>
            </title>
            <aug>
               <au>
                  <snm>Vernon</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Shukla</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Conradt</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>BMC Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>2</volume>
            <fpage>39</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">140017</pubid>
                  <pubid idtype="pmpid" link="fulltext">12498618</pubid>
                  <pubid idtype="doi">10.1186/1471-2180-2-39</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Human herpesviruses 6 and 7 in chronic fatigue syndrome: a case-control study</p>
            </title>
            <aug>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Stamey</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>Black</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Mawle</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Pellett</snm>
                  <fnm>PE</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2000</pubdate>
            <volume>31</volume>
            <fpage>48</fpage>
            <lpage>52</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/313908</pubid>
                  <pubid idtype="pmpid" link="fulltext">10913395</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Chronic fatigue syndrome is not associated with expression of endogenous retroviral p15E</p>
            </title>
            <aug>
               <au>
                  <snm>Gelman</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Mawle</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Nisenbaum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Molec Diagnosis</source>
            <pubdate>2000</pubdate>
            <volume>5</volume>
            <fpage>155</fpage>
            <lpage>156</lpage>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Absence of Mycoplasma species DNA in chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Vernon</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Shukla</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>J Med Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>52</volume>
            <fpage>1027</fpage>
            <lpage>1028</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1099/jmm.0.05316-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">14532349</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Isolation of novel virus-like sequences associated with human hepatitis</p>
            </title>
            <aug>
               <au>
                  <snm>Simons</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Leary</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Dawson</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Pilot-Matias</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Muerhoff</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Schlauder</snm>
                  <fnm>GG</fnm>
               </au>
               <au>
                  <snm>Desai</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Mushahwar</snm>
                  <fnm>IK</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>1995</pubdate>
            <volume>1</volume>
            <fpage>564</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm0695-564</pubid>
                  <pubid idtype="pmpid">7585124</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent</p>
            </title>
            <aug>
               <au>
                  <snm>Linnen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wages</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zhang-Keck</snm>
                  <fnm>Z-Y</fnm>
               </au>
               <au>
                  <snm>Fry</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Krawczynski</snm>
                  <fnm>KZ</fnm>
               </au>
               <au>
                  <snm>Alter</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Koonin</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gallagher</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Alter</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hadziyannis</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Karayiannis</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Fung</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakatsuji</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shih</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Piatak</snm>
                  <fnm>M</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zou</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hyams</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Ismay</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lifson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Hess</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Foung</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Margolis</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1996</pubdate>
            <volume>271</volume>
            <fpage>505</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8560265</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Detection of active hepatitis C virus and hepatitis G virus/GB virus C replication in bone marrow in human subjects</p>
            </title>
            <aug>
               <au>
                  <snm>Radkowski</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kubicka</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kisiel</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cianciara</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nowicki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rakela</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Laskus</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2000</pubdate>
            <volume>95</volume>
            <fpage>3986</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10845938</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Alphabet of hepatitis viruses</p>
            </title>
            <aug>
               <au>
                  <snm>Zuckerman</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>1996</pubdate>
            <volume>347</volume>
            <fpage>558</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(96)91267-2</pubid>
                  <pubid idtype="pmpid">8596314</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Sequence and genomic organization of GBV-C: a novel member of the flaviviridae associated with human non-A-E hepatitis</p>
            </title>
            <aug>
               <au>
                  <snm>Leary</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Muerhoff</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Simons</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Pilot-Matias</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Erker</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Chalmers</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Schlauder</snm>
                  <fnm>GG</fnm>
               </au>
               <au>
                  <snm>Dawson</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Desai</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>J Med Virol</source>
            <pubdate>1996</pubdate>
            <volume>48</volume>
            <fpage>60</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-9071(199601)48:1&lt;60::AID-JMV10>3.0.CO;2-A</pubid>
                  <pubid idtype="pmpid">8825712</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>GB Virus Type C: a beneficial infection?</p>
            </title>
            <aug>
               <au>
                  <snm>Stapleton</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Xiang</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2004</pubdate>
            <volume>42</volume>
            <fpage>3915</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">516331</pubid>
                  <pubid idtype="pmpid" link="fulltext">15364968</pubid>
                  <pubid idtype="doi">10.1128/JCM.42.9.3915-3919.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Hepatitis G virus/GBV-C persistence: absence of hypervariable E2 region and genetic analysis of viral quasispecies in serum and lymphocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Zampino</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pickering</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Iqbal</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gaud</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Karayiannis</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>J Viral Hepatitis</source>
            <pubdate>1999</pubdate>
            <volume>6</volume>
            <fpage>209</fpage>
            <lpage>18</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1046/j.1365-2893.1999.00162.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Innate and adaptive immune responses determine protection against disseminated infection by West Nile encephalitis virus</p>
            </title>
            <aug>
               <au>
                  <snm>Diamond</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Shrestha</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mehlhop</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Sitati</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Engle</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Viral Immunol</source>
            <pubdate>2003</pubdate>
            <fpage>259</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/088282403322396082</pubid>
                  <pubid idtype="pmpid" link="fulltext">14583143</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Complement activation in a model of chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Sorensen</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Streib</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Strand</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Make</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Giclas</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Fleshner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2003</pubdate>
            <volume>112</volume>
            <fpage>397</fpage>
            <lpage>403</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mai.2003.1615</pubid>
                  <pubid idtype="pmpid" link="fulltext">12897748</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Differential display PCR of peripheral blood for biomarker discovery in chronic fatigue syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Steinau</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Rajeevan</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>J Mol Med</source>
            <pubdate>2004</pubdate>
            <volume>82</volume>
            <fpage>750</fpage>
            <lpage>5</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00109-004-0586-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">15490094</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Integration of gene expression, clinical, and epidemiologic data to characterize Chronic Fatigue Syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Whistler</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Nisenbaum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Vernon</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>J Transl Med</source>
            <pubdate>2003</pubdate>
            <volume>1</volume>
            <fpage>10</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">305360</pubid>
                  <pubid idtype="pmpid" link="fulltext">14641939</pubid>
                  <pubid idtype="doi">10.1186/1479-5876-1-10</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Association of antibody to GB virus C (hepatitis G virus) with viral clearance and protection from reinfection</p>
            </title>
            <aug>
               <au>
                  <snm>Thomas</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Vlahov</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Alter</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Hunt</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Astemborski</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>KE</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>1998</pubdate>
            <volume>177</volume>
            <fpage>539</fpage>
            <lpage>42</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9498429</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Seroprevalence of GB virus C and persistence of RNA and antibody</p>
            </title>
            <aug>
               <au>
                  <snm>Gutierrez</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Dawson</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Knigge</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Melvin</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Heynen</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Kyrk</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Carrick</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Schlauder</snm>
                  <fnm>GG</fnm>
               </au>
               <au>
                  <snm>Surowy</snm>
                  <fnm>TK</fnm>
               </au>
               <au>
                  <snm>Dille</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Coleman</snm>
                  <fnm>PF</fnm>
               </au>
               <au>
                  <snm>Thiele</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Lentino</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Pachucki</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Mushahwar</snm>
                  <fnm>IK</fnm>
               </au>
            </aug>
            <source>J Med Viro</source>
            <pubdate>1997</pubdate>
            <volume>53</volume>
            <fpage>167</fpage>
            <lpage>73</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1002/(SICI)1096-9071(199710)53:2&lt;167::AID-JMV10>3.0.CO;2-G</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Surveillance for chronic fatigue syndrome&#8211;four U.S. cities, September 1989 through August 1993</p>
            </title>
            <aug>
               <au>
                  <snm>Reyes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gary</snm>
                  <fnm>HE</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Dobbins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Randall</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Steele</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Fukuda</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Holmes</snm>
                  <fnm>GP</fnm>
               </au>
               <au>
                  <snm>Connell</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Mawle</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Schmid</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Schonberger</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Gunn</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>MMWR CDC Surveill Summ</source>
            <pubdate>1997</pubdate>
            <volume>46</volume>
            <fpage>1</fpage>
            <lpage>13</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12412768</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Chronic fatigue syndrome: a working case definition</p>
            </title>
            <aug>
               <au>
                  <snm>Holmes</snm>
                  <fnm>GP</fnm>
               </au>
               <au>
                  <snm>Kaplan</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Gantz</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Komaroff</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Schonberger</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Straus</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Dubois</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Cunningham-Rundles</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pahwa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tosato</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Zegans</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Purtilo</snm>
                  <fnm>DT</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Schooley</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Brus</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Ann Intern Med</source>
            <pubdate>1988</pubdate>
            <volume>108</volume>
            <fpage>387</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2829679</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Immune responses associated with chronic fatigue syndrome: a case-control study</p>
            </title>
            <aug>
               <au>
                  <snm>Mawle</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Nisenbaum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Dobbins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Gary</snm>
                  <fnm>HE</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Steele</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Schmid</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>1997</pubdate>
            <volume>175</volume>
            <fpage>136</fpage>
            <lpage>41</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8985207</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>The GB viruses</p>
            </title>
            <aug>
               <au>
                  <snm>Simons</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Desai</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Mushahwar</snm>
                  <fnm>IK</fnm>
               </au>
            </aug>
            <source>Curr Top Microbiol Immunol</source>
            <pubdate>2000</pubdate>
            <volume>242</volume>
            <fpage>341</fpage>
            <lpage>75</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10592668</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Chronic fatigue syndrome and arthralgia following parvovirus B19 infection</p>
            </title>
            <aug>
               <au>
                  <snm>Kerr</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Bracewell</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Laing</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Mattey</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Bernstein</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Bruce</snm>
                  <fnm>IN</fnm>
               </au>
               <au>
                  <snm>Tyrrell</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>2002</pubdate>
            <volume>29</volume>
            <fpage>595</fpage>
            <lpage>602</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11911112</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Detection of antibody against Borna disease virus-p24 in the plasma of Chinese patients with chronic fatigue syndrome by Western-blot analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>DX</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>ZD</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>AY</fnm>
               </au>
               <au>
                  <snm>Ykuta</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi</source>
            <pubdate>2003</pubdate>
            <volume>17</volume>
            <fpage>330</fpage>
            <lpage>3</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15340544</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2334/5/78/prepub</url>
         </p>
      </sec>
   </bm>
</art>
