<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2334-2-13</ui>
   <ji>1471-2334</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>A quantitative PCR (TaqMan) assay for pathogenic <it>Leptospira spp</it></p>
         </title>
         <aug>
            <au id="A1">
               <snm>Smythe</snm>
               <mi>D</mi>
               <fnm>Lee</fnm>
               <insr iid="I1"/>
               <email>lee_smythe@health.qld.gov.au</email>
            </au>
            <au id="A2">
               <snm>Smith</snm>
               <mi>L</mi>
               <fnm>Ina</fnm>
               <insr iid="I2"/>
               <email>Ina_smith@health.qld.gov.au</email>
            </au>
            <au id="A3">
               <snm>Smith</snm>
               <mi>A</mi>
               <fnm>Greg</fnm>
               <insr iid="I2"/>
               <email>greg_smith@health.qld.gov.au</email>
            </au>
            <au id="A4">
               <snm>Dohnt</snm>
               <mi>F</mi>
               <fnm>Michael</fnm>
               <insr iid="I1"/>
               <email>michael_dohnt@health.qld.gov.au</email>
            </au>
            <au id="A5">
               <snm>Symonds</snm>
               <mi>L</mi>
               <fnm>Meegan</fnm>
               <insr iid="I1"/>
               <email>meegan_symonds@health.qld.gov.au</email>
            </au>
            <au id="A6">
               <snm>Barnett</snm>
               <mi>J</mi>
               <fnm>Leonie</fnm>
               <insr iid="I1"/>
               <email>leonie_barnett@health.qld.gov.au</email>
            </au>
            <au id="A7" ca="yes">
               <snm>McKay</snm>
               <mi>B</mi>
               <fnm>David</fnm>
               <insr iid="I3"/>
               <email>dmckay@usc.edu.au</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>WHO/FAO/OIE Collaborating Centre for Reference &amp; Research on Leptospirosis, Centre for Public Health Sciences, Queensland Health Scientific Services, Brisbane, Australia</p>
            </ins>
            <ins id="I2">
               <p>Public Health Virology, Centre for Public Health Sciences, Queensland Health Scientific Services, Brisbane, Australia</p>
            </ins>
            <ins id="I3">
               <p>Sippy Downs Drive, University of the Sunshine Coast, Maroochydore, 4558 Queensland, Australia</p>
            </ins>
         </insg>
         <source>BMC Infectious Diseases</source>
         <issn>1471-2334</issn>
         <pubdate>2002</pubdate>
         <volume>2</volume>
         <issue>1</issue>
         <fpage>13</fpage>
         <url>http://www.biomedcentral.com/1471-2334/2/13</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/1471-2334-2-13</pubid>
               <pubid idtype="pmpid">12100734</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>4</day>
               <month>4</month>
               <year>2002</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>8</day>
               <month>7</month>
               <year>2002</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>8</day>
               <month>7</month>
               <year>2002</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2002</year>
         <collab>Smythe et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <kwdg>
         <kwd>Leptospirosis</kwd>
         <kwd>TaqMan</kwd>
         <kwd>real-time PCR</kwd>
         <kwd>diagnosis</kwd>
      </kwdg>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Leptospirosis is an emerging infectious disease. The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis. There are over 230 known serovars in the genus <it>Leptospira</it>. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT) which relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. Other techniques, such as the enzyme linked immunosorbent assay (ELISA) and slide agglutination test (SAT), can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>The polymerase chain reaction (PCR) has been used to detect a large number of microorganisms, including those of clinical significance. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. We employed real-time (quantitative) PCR using TaqMan chemistry to detect leptospires in clinical and environmental samples.</p>
            </sec>
            <sec>
               <st>
                  <p>Results and Conclusions</p>
               </st>
               <p>The PCR assay can be applied to either blood or urine samples and does not rely on the isolation and culture of the organism. Capability exists for automation and high throughput testing in a clinical laboratory. It is specific for <it>Leptospira</it> and may discriminate pathogenic and non-pathogenic species. The limit of detection is as low as two cells.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Leptospirosis is an emerging infectious disease <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. <it>Leptospira spp</it>. are endemic to feral and domestic animals that may serve as reservoirs, with rats and rodents recognised as the most important sources <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Human infections result from contact with contaminated soil, vegetation or water, or with the body fluids of infected animals. The genus <it>Leptospira</it> comprises both pathogenic and non-pathogenic species: <it>L. interrogans, L. borgpetersenii, L. weilii, L. noguchii, L. meyeri, L. fainei, L. alexanderi, L. santarosai, L. kirschneri, L. inadai</it>; <it>L. biflexa,</it> and <it>L. wolbachii</it><abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. There is some controversy about the classification or pathogenicity of some members within species such as <it>L. meyeri</it> and <it>L. inadai</it><abbrgrp><abbr bid="B2">2</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>.</p>
         <p>The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. For example, patients presenting with severe fever and haemorrhage have symptoms which are difficult to distinguish from viral haemorrhagic fever <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
         <p>There are over 230 known serovars in the genus <it>Leptospira</it><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT) which is able to detect specific antibody produced against the infecting leptospiral organism <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The MAT relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. A specific antibody response detectable by the MAT generally occurs at around 8&#8211;10 days after onset of the illness <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. The MAT is generally performed by reference laboratories due to the inherent safety risks of handling cultures of live leptospiral organisms, the high cost of commercial media, and the need for ongoing maintenance of representative serovars or serogroups. Other techniques, such as the enzyme linked immunosorbent assay (ELISA) and slide agglutination test (SAT), can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
         <p>Isolation of leptospires from human specimens is possible for limited periods in the course of the infection. This may be due to limited survival of the organism in the collected primary tissue or body fluid sample, immune system responses, or exposure to administered antibiotics <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. Culture may take up to eight weeks and must be examined weekly. In the acute phase, which lasts up to about 10 days, leptospires may be cultured from the blood or cerebrospinal fluid (CSF), <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
         <p>The polymerase chain reaction (PCR) has been used to detect a large number of microorganisms, including those of clinical significance <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. Moreover, using real-time PCR, it is possible to quantify the amount of template and therefore the number of target organisms. Such quantitation can be achieved using a number of approaches, for example employing TaqMan chemistry <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>.</p>
         <p>Attempts have been made to design PCR primers specifically for <it>Leptospira spp</it>. as reviewed by Levett <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. It has been difficult to identify all pathogenic species and, in some instances, to discriminate between non-pathogenic and pathogenic species. Although Woo <it>et al.</it>, <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp> have employed TaqMan fluorogenic probes on leptospires, this non-clinically directed research concentrated on the use of TaqMan probes for the differentiation and identification of <it>Leptospira</it> species using pure isolates obtained from a reference culture collection.</p>
         <p>In this paper, we report on the development of real-time detection of <it>Leptospira</it> spp. using a TaqMan fluorogenic probe. The assay is sensitive and appears able to differentiate between pathogenic and non-pathogenic species with highly sensitive limits of detection on clinical samples and without the need for prior isolation and culture.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and Methods</p>
         </st>
         <p>We have received appropriate ethics approval for this work and have complied with the Helsinki declaration.</p>
         <sec>
            <st>
               <p>DNA preparation</p>
            </st>
            <p>Genomic DNA from non-leptospiral bacterial strains (Table <tblr tid="T1">1</tblr>) was extracted as described in <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Total DNA from human serum (200 &#956;l) and urine (200 &#956;l) was prepared using QIAamp DNA Mini Kits (QIAGEN, Australia) according to the manufacturer's instructions.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>List of bacterial strains used for TaqMan PCR</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Strain</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Source</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Escherichia coli</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 10418</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Yersinia enterocolitica</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ATCC 9610</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Shigella sonnei</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>PHM 205</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Escherichia coli</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 9001</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Enterobacter aerogenes</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 10006</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Pseudomonas aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 10332</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Citrobacter freundii</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 9750</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Pseudomonas fluorescens</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 10038</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Proteus vulgaris</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 4635</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Klebsiella pneumoniae</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>PHM 15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Alcaligenes faecalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ATCC 15246</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Salmonella salford</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>IMVS 1710</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Vibrio cholerae</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACM 3983</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Pasteurella multocida</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UQ</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Salmonella dublin</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>PHM 82</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Borrelia burgdorferi</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>B31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Staphylococcus epidermis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 6513</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Staphyloccocus aureus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 6513</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Bacillus cereus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>PHM3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Enterococcus faecalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NCTC 775</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Listeria seeligeri</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>PHM20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Listeria monocytogenes</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>PHM19</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>NCTC: National Collection of Type Cultures, Collindale, USA ATCC: American Type Culture Collection, USA PHM: Public Health Microbiology, Brisbane, Australia IMVS: Institute of Medical and Veterinary Science, Adelaide, Australia ACM: Australian Culture Microorganisms, Brisbane, Australia UQ: University of Queensland, Brisbane, Australia ICPMR: Institute of Clinical Pathology and Medical Research, Westmead, NSW, Australia</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Collection and testing of human sera</p>
            </st>
            <p>Single serum samples were from 66 patients with clinically suspected leptospirosis or from "at risk" occupations or activities, for example persons in industries associated with animal contact and agricultural workers <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. These sera were tested by combinations of polymerase chain reaction (PCR), microscopic agglutination test (MAT) and a commercially available anti-IgM ELISA (Pan Bio Pty Ltd, Brisbane, Australia). Blood culture was conducted using 2&#8211;5 drops of whole blood placed into Ellinghausen McCullough Johnson Harris medium (EMJH) solidified with 1.5% agarose and incubated at 37&#176;C for up to seven weeks.</p>
            <p>Patient serum samples tested by MAT had a starting dilution of 1:50 and a diagnostic result (indicative of current infection) declared where there was a fourfold change of titre between acute and convalescent sera or a titre of 400 or greater was found with a single specimen. A positive ELISA was confirmed by the MAT <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
            <p>All serum samples were subjected to PCR. Fifty-two of the serum samples were subjected to ELISA and 40 of the patients had blood culture requested by a clinician. Forty-nine of the samples were subjected to MAT where there was sufficient serum and/or a positive ELISA result.</p>
         </sec>
         <sec>
            <st>
               <p>Bacterial strains</p>
            </st>
            <p>Bacterial strains used in this study other than members of the genus <it>Leptospira,</it> are shown in Table <tblr tid="T1">1</tblr>. <it>Leptospira</it> strains were from the WHO/FAO/OIE Collaborating Centre collection and are given in Table <tblr tid="T2">2</tblr>. Representatives of available non-pathogenic and pathogenic <it>Leptospira</it> species as defined by Yasuda et al. <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> were included in the study. The most commonly reported representative non-pathogenic, free living strain, <it>L. biflexa</it> serovar patoc strain Patoc 1, was included <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B19">19</abbr><abbr bid="B1">1</abbr></abbrgrp>. All cultures were grown in EMJH broth (Difco Laboratories, Detroit, Michigan) and maintained by weekly subculture into fresh medium. Cultures used were grown up to seven days at 30&#176;C to stationary phase to a density of approximately 2 &#215; 10<sup>8</sup> cells per ml.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Leptospiral serovars used for TaqMan PCR</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Serogroup</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Serovar</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Strain</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Pathogenic</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Celledoni</p>
                     </c>
                     <c ca="left">
                        <p>celledoni</p>
                     </c>
                     <c ca="left">
                        <p>Celledoni</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. weilii</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Bataviae</p>
                     </c>
                     <c ca="left">
                        <p>bataviae</p>
                     </c>
                     <c ca="left">
                        <p>Swart</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Canicola</p>
                     </c>
                     <c ca="left">
                        <p>canicola</p>
                     </c>
                     <c ca="left">
                        <p>Hond Utrecht IV</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Icterohaemorrhagiaea</p>
                     </c>
                     <c ca="left">
                        <p>copenhageni</p>
                     </c>
                     <c ca="left">
                        <p>M20</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Javanica</p>
                     </c>
                     <c ca="left">
                        <p>javanica</p>
                     </c>
                     <c ca="left">
                        <p>Veldrat Batavia 46</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. borgpeterseni</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ballum</p>
                     </c>
                     <c ca="left">
                        <p>ballum</p>
                     </c>
                     <c ca="left">
                        <p>Mus 127</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. borgpeterseni</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Hebdomadis</p>
                     </c>
                     <c ca="left">
                        <p>kremastos</p>
                     </c>
                     <c ca="left">
                        <p>Kremastos</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Sejroe</p>
                     </c>
                     <c ca="left">
                        <p>hardjo</p>
                     </c>
                     <c ca="left">
                        <p>Hardjobovis</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. borgpeterseni</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Grippotyphosa</p>
                     </c>
                     <c ca="left">
                        <p>grippotyphosa</p>
                     </c>
                     <c ca="left">
                        <p>Moska V</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Djasiman</p>
                     </c>
                     <c ca="left">
                        <p>djasiman</p>
                     </c>
                     <c ca="left">
                        <p>Djasiman</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Tarassovi</p>
                     </c>
                     <c ca="left">
                        <p>tarassovi</p>
                     </c>
                     <c ca="left">
                        <p>Perepelitsin</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. borgpeterseni</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Australis</p>
                     </c>
                     <c ca="left">
                        <p>australis</p>
                     </c>
                     <c ca="left">
                        <p>Ballico</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Sejroe</p>
                     </c>
                     <c ca="left">
                        <p>medanensis</p>
                     </c>
                     <c ca="left">
                        <p>Hond HC</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Panama</p>
                     </c>
                     <c ca="left">
                        <p>panama</p>
                     </c>
                     <c ca="left">
                        <p>CZ214 K</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. noguchi</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pyrogenes</p>
                     </c>
                     <c ca="left">
                        <p>robinsoni</p>
                     </c>
                     <c ca="left">
                        <p>Robinson</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Autumnalis</p>
                     </c>
                     <c ca="left">
                        <p>bulgarica</p>
                     </c>
                     <c ca="left">
                        <p>Nicolaevo</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. kirschneri</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Szwajizak</p>
                     </c>
                     <c ca="left">
                        <p>szwajizak</p>
                     </c>
                     <c ca="left">
                        <p>Mini</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pomona</p>
                     </c>
                     <c ca="left">
                        <p>pomona</p>
                     </c>
                     <c ca="left">
                        <p>Pomona</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Hurstbridge</p>
                     </c>
                     <c ca="left">
                        <p>hurstbridge</p>
                     </c>
                     <c ca="left">
                        <p>BUT 6</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. fainei</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pyrogenes</p>
                     </c>
                     <c ca="left">
                        <p>zanoni</p>
                     </c>
                     <c ca="left">
                        <p>Zanoni</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. interrogans</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Cynopteri</p>
                     </c>
                     <c ca="left">
                        <p>cynopteri</p>
                     </c>
                     <c ca="left">
                        <p>3522 C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. kirschneri</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Shermani</p>
                     </c>
                     <c ca="left">
                        <p>shermani</p>
                     </c>
                     <c ca="left">
                        <p>1342 K</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. santarosai</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Non-pathogenic<sup>a</sup></b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Semaranga</p>
                     </c>
                     <c ca="left">
                        <p>patoc</p>
                     </c>
                     <c ca="left">
                        <p>Patoc 1</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. biflexa</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Codice</p>
                     </c>
                     <c ca="left">
                        <p>codice</p>
                     </c>
                     <c ca="left">
                        <p>CDC</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. wolbachi</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Andamana</p>
                     </c>
                     <c ca="left">
                        <p>andaman</p>
                     </c>
                     <c ca="left">
                        <p>CH11</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. biflexa</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Leptonema</p>
                     </c>
                     <c ca="left">
                        <p>illini</p>
                     </c>
                     <c ca="left">
                        <p>3055</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Leptonema illini</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Lyme</p>
                     </c>
                     <c ca="left">
                        <p>lyme</p>
                     </c>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. inadai</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ranarum</p>
                     </c>
                     <c ca="left">
                        <p>ranarum</p>
                     </c>
                     <c ca="left">
                        <p>ICF</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. meyeri</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Pathogenicity controversial</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mini</p>
                     </c>
                     <c ca="left">
                        <p>perameles</p>
                     </c>
                     <c ca="left">
                        <p>Bandicoot 343</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>L. meyeri</it>
                           <sup>b</sup>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Feral</p>
                     </c>
                     <c ca="left">
                        <p><it>L. inadai-</it>lik<it>e</it></p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>All species are non-pathogenic as reported by Yasuda et al. <abbrgrp><abbr bid="B5">5</abbr></abbrgrp><sup>b</sup> This species classification has been controversial as reported by Postic et al. <abbrgrp><abbr bid="B4">4</abbr></abbrgrp></p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Design of TaqMan probes and PCR primers</p>
            </st>
            <p>The primers and probes were designed from alignments of available <it>Leptospira spp.</it> 16S rDNA partial sequences obtained from the GenBank nucleotide sequence database (data not shown). The program used was Primer Express&#8482; (Perkin-Elmer, Applied Biosystems, USA). The ability of the primers and probe to identify leptospiral sequences was initially assessed using the BLAST program <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> against the National Center for Biotechnology Information (NCBI) sequence database. The primers were synthesized by Geneworks Pty. Ltd., Australia and the probe by Pacific Oligos Pty Ltd, Australia.</p>
            <p>The PCR primers Lepto F (5'<sup>171</sup> CCCGCGTCCGATTAG 3') and Lepto R (5'<sup>258</sup> TCCATTGTGGCCGR<sup>A/G</sup>ACAC3') were located between the positions 171 and 258 of the <it>rrs</it> (16S) gene with an expected product size of 87 bp product. The probe [5'<sup>205</sup>(FAM) CTCACCAAGGCGACGATCGGTAGC<sup>228</sup> 3' (TAMRA)] had the fluorescent reporter dye, 6-carboxy-fluorescein (FAM) located at the 5' end of the probe and the quencher 6-carboxy-tetramethyl-rhodamine (TAMRA) located at the 3' end.</p>
         </sec>
         <sec>
            <st>
               <p>PCR conditions</p>
            </st>
            <p>For all PCRs, 5 &#956;l of DNA was added to the 45 &#956;l TaqMan Universal PCR Mastermix Mix (Applied Biosystems, Foster City, CA) part number 4304437, providing final concentrations of 3 pmol/&#956;l of each primer and 2 pmol/&#956;l of the FAM-TAMRA labelled probe. A no template control (NTC) that contained all the above reagents was also included to detect the presence of contaminating DNA. Amplification and fluorescence detection was conducted in an ABI Prism 7700 sequence detector (Perkin &#8211; Elmer, Applied Biosystems, USA) with a program of 40 cycles, each cycle consisting of 95&#176;C for 15 seconds and 60&#176;C for one minute. A negative result was assigned where no amplification occurred, i.e. the threshold cycle (Ct) value was greater than 40 cycles.</p>
            <p>DNA template at dilutions of 1:100, 1:1000, 1:2000, 1:4000 and 1:8000 for non-leptospiral cells and leptospiral culture dilutions from 10<sup>8</sup> to 10<sup>0</sup> were prepared using pH 7.4 phosphate buffered saline solution <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. The number of cells in culture was determined using a Petroff Hauser bacterial counting chamber <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> and adjusted to an initial concentration of 10<sup>8</sup> cells per ml. For DNA extraction of non-leptospiral cells, a single colony was picked (except in the case of <it>Borrelia burdorferi</it> where a 200 &#956;l aliquot of heat-killed whole antigen was used) then mixed in 500 &#956;l of sterile distilled water. Analyses of non-leptospiral samples were run in triplicate and leptospiral cells in duplicate.</p>
         </sec>
         <sec>
            <st>
               <p>Detection of PCR inhibitors</p>
            </st>
            <p>Blood (negative by MAT for leptospirosis antibodies) was collected from a single source using each of the collection tube systems listed in Table <tblr tid="T3">3</tblr>. Serum or plasma was then prepared from these blood samples and 200 &#956;l of each of these samples was then extracted using a QIAamp Mini Kit and the DNA eluted with 200 &#956;l of elution buffer. A 5 &#956;l volume of these DNA extracts was added to individual PCR reaction tubes containing a standard amount of DNA corresponding to a known Ct value. The test samples were run in triplicate.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>List of sample collection tubes</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Collection Tube Description</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>TaqMan Result (Average Ct)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Lithium Heparin</p>
                     </c>
                     <c ca="left">
                        <p>23.40</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>EDTA, Liquid (K2)</p>
                     </c>
                     <c ca="left">
                        <p>18.50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Sodium Citrate 3.2 %</p>
                     </c>
                     <c ca="left">
                        <p>18.25</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>EDTA (Spray Coated), (K2)</p>
                     </c>
                     <c ca="left">
                        <p>18.37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fluoride Oxalate</p>
                     </c>
                     <c ca="left">
                        <p>18.61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Clot activator</p>
                     </c>
                     <c ca="left">
                        <p>19.03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Plasma Separation Tube (PST), Lithium Heparin and Polymer Gel</p>
                     </c>
                     <c ca="left">
                        <p>21.79</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Acid Citrate Dextrose (ACD) Solution A</p>
                     </c>
                     <c ca="left">
                        <p>18.35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Clot activator and Polymer gel</p>
                     </c>
                     <c ca="left">
                        <p>18.20</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Specificity and sensitivity of the PCR assay</p>
            </st>
            <p>To assess the specificity of the primers and probe, 29 leptospiral strains (Table <tblr tid="T2">2</tblr>) and 22 other bacterial pathogens (Table <tblr tid="T1">1</tblr>) were subjected to PCR. A detectable product was observed for all the 23 pathogenic leptospiral strains. Other bacterial strains and non-pathogenic leptospiral strains did not yield amplification products.</p>
            <p>The sensitivity of the assay was evaluated using DNA extracted from 10<sup>8</sup>&#8211;10<sup>0</sup> tenfold dilutions of two <it>Leptospira</it> reference cultures <it>L. borgpeterseni</it> serovar hardjo and <it>L. interrogans</it> serovar pomona. A minimum detection limit of approximately two cells was established in the PCR reaction mixture.</p>
         </sec>
         <sec>
            <st>
               <p>Detection of leptospiral DNA in human clinical specimens</p>
            </st>
            <p>To assess the ability of the PCR to detect the presence of leptospiral cells in human serum, 66 patients were tested who had clinical symptoms consistent with leptospirosis and/or were from "at risk" occupations or activities. Isolation of leptospires, MAT and ELISA were not attempted on all patients (see Materials and Methods for details).</p>
            <p>For the 49 patients tested by MAT, 17 were positive with titres ranging from 50 to 3200. Of the 17 samples which tested positive, three were equivocal using ELISA and all 17 did not produce a product using PCR. Of the twenty seven patients found negative using ELISA, and the 36 negative by culture, all were determined negative by PCR.</p>
            <p>Four serum samples which tested negative using MAT did produce a PCR product. Furthermore, these samples yielded a positive result by culture. Three of these samples later showed diagnostic rises by MAT (Table <tblr tid="T4">4</tblr>). Unfortunately no serum for the fourth patient was available for MAT but the isolate was preliminarily identified by MAT as equivalent to <it>L. interrogans</it> serovar zanoni (Table <tblr tid="T4">4</tblr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Details of patients positive by TaqMan assay</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Patient</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Age(yr)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sex</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>MAT<sup>a</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>MAT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Serovar</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>ELISA<sup>b</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Culture</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>CT (Average)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>M</p>
                     </c>
                     <c ca="center">
                        <p>ND (10/7/01)</p>
                     </c>
                     <c ca="center">
                        <p>400 (20/7/01)</p>
                     </c>
                     <c ca="center">
                        <p>hardjo</p>
                     </c>
                     <c ca="center">
                        <p>NT</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>37.75</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>M</p>
                     </c>
                     <c ca="center">
                        <p>ND (2/3/01)</p>
                     </c>
                     <c ca="center">
                        <p>800 (16/3/01)</p>
                     </c>
                     <c ca="center">
                        <p>tarassovi</p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>36.03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>M</p>
                     </c>
                     <c ca="center">
                        <p>ND (14/5/01)</p>
                     </c>
                     <c ca="center">
                        <p>200 (16/5/01)</p>
                     </c>
                     <c ca="center">
                        <p>pomona</p>
                     </c>
                     <c ca="center">
                        <p>NT</p>
                     </c>
                     <c ca="center">
                        <p>NT</p>
                     </c>
                     <c ca="center">
                        <p>38.44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>28</p>
                     </c>
                     <c ca="center">
                        <p>M</p>
                     </c>
                     <c ca="center">
                        <p>NT</p>
                     </c>
                     <c ca="center">
                        <p>NT</p>
                     </c>
                     <c ca="center">
                        <p>zanoni</p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>39.87</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Microscopic agglutination tests (date of collection) <sup>b</sup>Enzyme linked immunosorbent assay NT: Not Tested ND: Not Detected</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Detection of <it>Leptospira spp.</it> in urine</p>
            </st>
            <p>To assess the ability of the PCR to detect the presence of leptospiral cells in urine, serial tenfold dilutions of cells of <it>L. interrogans</it> serovar icterohaemorrhagiae (with numbers confirmed using a Petroff-Hauser counting chamber) were mixed with urine from a leptospirosis-negative source and tested in duplicate by PCR. The estimated limit of detection was 10 cells. The results suggest an ability of the PCR to detect leptospires in clinical urine samples but this needs to be further evaluated.</p>
         </sec>
         <sec>
            <st>
               <p>Blood collection system inhibition</p>
            </st>
            <p>We tested representatives of a number of standard clinical blood collection systems which contained chemical components which may interfere with PCR. Only those collection systems (Table <tblr tid="T3">3</tblr>) containing lithium heparin interfered with the PCR. Collection tubes containing lithium heparin demonstrated mean Ct values of 23.97 and 21.7 compared to the expected value of 18.32.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>This report describes the development of a real-time PCR assay employing a TaqMan probe for the detection and quantitation of organisms belonging to the genus <it>Leptospira.</it> The assay detected pathogenic <it>Leptospira</it> species, but seemed not to detect non-pathogenic strains (see Table <tblr tid="T2">2</tblr>), nor a number of commonly-occurring non-leptospiral pathogens (see Table <tblr tid="T1">1</tblr>), including the spirochete <it>Borrelia burdorferi</it>. There is some contention about whether <it>L. meyeri</it> and <it>L. inadai</it> are pathogenic <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B4">4</abbr></abbrgrp>. We observed an amplification product for <it>L. meyeri</it> serovar perameles strain bandicoot 343, a strain considered by at least one group to be pathogenic <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. The amplification product obtained for our strain Feral, an <it>inadai</it> species like organism <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> but not <it>L. inadai</it> serovar lyme strain 10, a non-pathogen, suggests the PCR detects some members within this species but further evaluation of strain Feral will need to be undertaken.</p>
         <p>The ability of the PCR to distinguish between pathogenic and non-pathogenic <it>Leptospira</it> species may be useful for the testing of environmental samples but this will require further evaluation. The non-pathogenic representative of <it>L. biflexa</it> used in this study is the most commonly-described environmental contaminant and frequently confuses the identification of pathogenic strains from environmental samples. Culture under specialized conditions facilitates discrimination between <it>L. biflexa</it> and other pathogenic species, it is however possible the PCR could provide an alternate or supporting role for identification.</p>
         <p>This PCR assay provides the potential to detect pathogenic <it>Leptospira spp.</it> in a range of clinical specimens providing for earlier diagnosis and unequivocal evidence of active infection. As reported for the detection of meningococcal cells <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, the PCR assay developed in this work will provide an enhanced capability for confirmation of cases where early antibiotic treatment has precluded detection by culture. Opportunity also exists for better postmortem testing where samples are generally of poor quality and do not lend themselves to culturing or serology.</p>
         <p>The limit of detection of leptospires in urine was approximately 10 cells and for serum approximately 2 cells. The reason for the lower sensitivity in urine samples is not clear, however, two possible reasons are that a component in the urine sample was extracted with the DNA and interfered with the PCR <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, or that extraction of DNA from cells in urine is not as efficient as that in serum. The assay of Merien <it>et al. </it><abbrgrp><abbr bid="B23">23</abbr></abbrgrp> reported very similar detection levels for seeded urine samples. Bal et al. <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> successfully detected leptospires in patient urine by conventional PCR analysis but recorded problems of reproducibility and sensitivity with different extraction methods caused by the presence of inhibitors. Further investigations of extraction methods for urine will need to be undertaken to monitor the impact of inhibitors.</p>
         <p>Previously the diagnosis of leptospirosis has relied heavily on the detection of antibodies using either ELISA or MAT. In many cases, particularly in the early phase of infection, the lack of antibodies in patient sera results in an inability to confirm diagnosis. Patients presenting with clinical symptoms suggestive of leptospirosis will have an opportunity for early detection on a single specimen and the process has the potential to greatly enhance patient management through the timely commencement of medical treatment.</p>
         <p>Because real-time PCR enables the quantitative monitoring of leptospiral cells, there exists the opportunity to monitor treatment efficacy, in particular the use of chemotherapeutics. For example, patients in intensive care management, where ineffective treatment is life-threatening, would greatly benefit from direct measurements of infectious organisms.</p>
         <p>The PCR assay developed in this study can be completed in around 5 hours. This assay also lends itself to large-scale analysis due to the availability of high-throughput sequence detection systems.</p>
         <p>The tube collection systems evaluation demonstrated that lithium heparin may inhibit the PCR. The observed increase in Ct value for the lithium heparin tubes suggests that relevant controls need to be included.</p>
         <p>The assay will have application in the human and veterinary fields as both a research tool and supporting diagnostic test.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>We have developed a real-time PCR assay for the detection of leptospires in clinical and environmental samples. This method appears to discriminate pathogenic from non-pathogenic strains and can detect as few as 2 cells in serum and 10 cells in urine. The PCR method has a clear advantage over other methods such as the microscopic agglutination test (MAT) which relies on the detection of antibodies, the presence of which cannot be detected until days after infection.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>None declared</p>
      </sec>
      <sec>
         <st>
            <p>Authors' Contributions</p>
         </st>
         <p>L. Smythe conducted the molecular studies, sequence alignments and the culture of bacterial species, and participated significantly in the writing and reviews of the manuscript. I. Smith contributed to the design of part of this study, assisted with sequence alignments and aspects of the molecular studies. G. Smith participated in the writing of the manuscript and design of part of this study. M. Dohnt provided laboratory support and expertise for culture and maintenance of reference cultures, provided blind trial samples and also participated in the writing and review of the manuscript. M. Symonds provided laboratory support, collection of sera for the inhibition component of the study, growth medium preparation, culture maintenance and assistance with the writing and review of the manuscript. L. Barnett participated in the design of the study, critical review and writing of the manuscript. D. McKay provided expert input for writing and construction of the manuscript and also participated in the design of part of this study. All authors have read and approved the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank John Bates, Queensland Health Scientific Services, Brisbane, Queensland Australia; Dr Kirsty Townsend, University of Queensland, Brisbane, Australia and David Dickeson, Institute of Clinical Pathology and Medical Research, Westmead, New South Wales, Australia for kindly supplying bacterial cultures. Also Karen Thompson, Queensland Health, Queensland, Australia for technical support and Dr. David Warrilow, Queensland Health Scientific Services, Brisbane, Queensland, Australia for reviewing the manuscript.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Leptospirosis.</p>
            </title>
            <aug>
               <au>
                  <snm>Levett</snm>
                  <fnm>PN</fnm>
               </au>
            </aug>
            <source>Clin Micro Rev</source>
            <pubdate>2001</pubdate>
            <volume>14</volume>
            <fpage>296</fpage>
            <lpage>326</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">88975</pubid>
                  <pubid idtype="pmpid" link="fulltext">11292640</pubid>
                  <pubid idtype="doi">10.1128/CMR.14.2.296-326.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p><it>Leptospira</it> and Leptospirosis, 2<sup>nd</sup> Edition.</p>
            </title>
            <aug>
               <au>
                  <snm>Faine</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Adler</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bolin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Perolat</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Medi Sci Melbourne, Australia.</source>
            <pubdate>1999</pubdate>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The Australian Leptospirosis.</p>
            </title>
            <aug>
               <au>
                  <snm>Johnson</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>Med J Aust</source>
            <pubdate>1950</pubdate>
            <volume>2</volume>
            <fpage>724</fpage>
            <lpage>731</lpage>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Interset of partial 16S rDNA gene sequences to resolve heterogeneities between Leptospira collections: application to L. meyeri.</p>
            </title>
            <aug>
               <au>
                  <snm>Postic</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Riquelme</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Merien</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Perolat</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Baranton</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Res Micro</source>
            <pubdate>2000</pubdate>
            <volume>151</volume>
            <fpage>333</fpage>
            <lpage>341</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0923-2508(00)00156-X</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Identification of Leptospira <it>inadai</it> by Continuous Monitoring of Fluorogenic Hybridization Probes during Rapid-Cycle PCR.</p>
            </title>
            <aug>
               <au>
                  <snm>Woo</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Patel</snm>
                  <fnm>BKC</fnm>
               </au>
               <au>
                  <snm>Smythe</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Norris</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Symonds</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Dohnt</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Syst Appl Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>21</volume>
            <fpage>89</fpage>
            <lpage>96</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9741113</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Overview of the epidemiology, microbiology, and pathogenesis of <it>Leptospira spp.</it> in humans.</p>
            </title>
            <aug>
               <au>
                  <snm>Plank</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Deborah</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Microbes and Infection</source>
            <pubdate>2000</pubdate>
            <volume>2</volume>
            <fpage>1265</fpage>
            <lpage>1276</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1286-4579(00)01280-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">11008116</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Leptospirosis presenting as a haemorrhagic fever in a traveller from Africa.</p>
            </title>
            <aug>
               <au>
                  <snm>Heron</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Reiss-Levy</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Jacques</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Dickeson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Smythe</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sorell</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Med J Aust</source>
            <pubdate>1997</pubdate>
            <volume>167</volume>
            <fpage>477</fpage>
            <lpage>479</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9397062</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Development of a fluorogenic polymerase chain reaction assay (TaqMan) for the detection and quantification of varicella zoster virus.</p>
            </title>
            <aug>
               <au>
                  <snm>Hawrami</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Breuer</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Virol Methods</source>
            <pubdate>1999</pubdate>
            <volume>79</volume>
            <fpage>33</fpage>
            <lpage>40</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0166-0934(98)00176-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">10328533</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Detection of dengue virus RNA in patients after primary of secondary dengue infection by using the TaqMan automated amplification system.</p>
            </title>
            <aug>
               <au>
                  <snm>Laue</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Emmerick</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Schmitz</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Clin Micro</source>
            <pubdate>1999</pubdate>
            <volume>37</volume>
            <fpage>2543</fpage>
            <lpage>2547</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">85278</pubid>
                  <pubid idtype="pmpid" link="fulltext">10405398</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Development of Primers to O &#8211; Antigen biosynthesis genes for specific detection of <it>Escherichia coli</it> O157 by PCR.</p>
            </title>
            <aug>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Petrosko</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bolton</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Appl Environ Micro</source>
            <pubdate>1999</pubdate>
            <volume>65</volume>
            <fpage>2954</fpage>
            <lpage>2960</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">91442</pubid>
                  <pubid idtype="pmpid" link="fulltext">10388689</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Detection and quantitation of Salmonella in pure cultures using 5'-nuclease polymerase chain reaction.</p>
            </title>
            <aug>
               <au>
                  <snm>Nogva</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Lillehaug</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Int J Food Micro</source>
            <pubdate>1999</pubdate>
            <volume>51</volume>
            <fpage>191</fpage>
            <lpage>196</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-1605(99)00122-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">10574095</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Application of a fluorogenic PCR assay for typing and subtyping of influenza viruses in respiratory samples.</p>
            </title>
            <aug>
               <au>
                  <snm>Schweiger</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Zaddow</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Heckler</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Timm</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pauli</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Clin Micro</source>
            <pubdate>2000</pubdate>
            <volume>38</volume>
            <fpage>1552</fpage>
            <lpage>1558</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">86487</pubid>
                  <pubid idtype="pmpid" link="fulltext">10747142</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Development of a fluorogenic RT-PCR assay (TaqMan) for the detection of Hendra virus.</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>IL</fnm>
               </au>
               <au>
                  <snm>Halpin</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Warrilow</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>GA</fnm>
               </au>
            </aug>
            <source>J Virol Methods</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>33</fpage>
            <lpage>40</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0166-0934(01)00354-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">11543882</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Identification of pathogenic Leptospira genospecies by continuous monitoring of fluorogenic hybridization probes during rapid-cycle PCR.</p>
            </title>
            <aug>
               <au>
                  <snm>Woo</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Patel</snm>
                  <fnm>BKC</fnm>
               </au>
               <au>
                  <snm>Smythe</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Norris</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Symonds</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Dohnt</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>J Clin Micro</source>
            <pubdate>1997</pubdate>
            <volume>35</volume>
            <fpage>3140</fpage>
            <lpage>3146</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">230137</pubid>
                  <pubid idtype="pmpid" link="fulltext">9399509</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Identification of pathogenic <it>leptospira</it> by TaqMan probe in a Lightcycler.</p>
            </title>
            <aug>
               <au>
                  <snm>Woo</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Patel</snm>
                  <fnm>BKC</fnm>
               </au>
               <au>
                  <snm>Smythe</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Norris</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Symonds</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Dohnt</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Anal Biochem</source>
            <pubdate>1998</pubdate>
            <volume>256</volume>
            <fpage>132</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/abio.1997.2503</pubid>
                  <pubid idtype="pmpid" link="fulltext">9466808</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Molecular cloning: a laboratory manual, 2<sup>nd</sup> Edition.</p>
            </title>
            <aug>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Maniatis</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Cold Spring Harbor Laboratory New York.</source>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Review of leptospirosis notifications in Queensland and Australia: January 1998 &#8211; June 1999.</p>
            </title>
            <aug>
               <au>
                  <snm>Smythe</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Dohnt</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Symonds</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barnett</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Brookes</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Vallanjon</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Comm Dis Intell</source>
            <pubdate>2000</pubdate>
            <volume>24</volume>
            <fpage>153</fpage>
            <lpage>157</lpage>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Deoxyribonucleic acid relatedness between serogroups and serovars in the family <it>Leptospiraceae</it> with proposals for seven new <it>Leptospira</it> species.</p>
            </title>
            <aug>
               <au>
                  <snm>Yasuda</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Steigerwalt</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Sulzer</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Kaufmann</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Rogers</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Brenner</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Int J Syst Bacteriology</source>
            <pubdate>1987</pubdate>
            <volume>37</volume>
            <fpage>407</fpage>
            <lpage>415</lpage>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Distribution of the Genus <it>Leptospira</it> in soil and water.</p>
            </title>
            <aug>
               <au>
                  <snm>Henry</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Appl Environ Micro</source>
            <pubdate>1978</pubdate>
            <volume>31</volume>
            <fpage>99</fpage>
            <lpage>107</lpage>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Basic local alignment search tool.</p>
            </title>
            <aug>
               <au>
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Gish</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Myers</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1990</pubdate>
            <volume>215</volume>
            <fpage>403</fpage>
            <lpage>410</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmbi.1990.9999</pubid>
                  <pubid idtype="pmpid" link="fulltext">2231712</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Leptospirosis. Methods in laboratory diagnosis (revised edition).</p>
            </title>
            <aug>
               <au>
                  <snm>Sulzer</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Publication No. (CDC) 74&#8211;8275 Department of Health, Education and Welfare, Washington DC.</source>
            <pubdate>1976</pubdate>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Evaluation of the Applied Biosystems automated TaqMan polymerase chain reaction system for the detection of meningococcal DNA.</p>
            </title>
            <aug>
               <au>
                  <snm>Guiver</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Borrow</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Marsh</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gray</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kaczmarski</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Howells</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Boseley</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Fox</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>FEMS Microbiology Letters</source>
            <pubdate>2000</pubdate>
            <volume>28</volume>
            <fpage>173</fpage>
            <lpage>179</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0928-8244(00)00152-8</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Comparison of polymerase chain reaction with microagglutination test and culture for diagnosis of Leptospirosis.</p>
            </title>
            <aug>
               <au>
                  <snm>Merien</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Baranton</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Perolat</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>1995</pubdate>
            <volume>172</volume>
            <fpage>281</fpage>
            <lpage>285</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7797932</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Detection of Leptospires in urine by PCR for early diagnosis of leptospirosis.</p>
            </title>
            <aug>
               <au>
                  <snm>Bal</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Gravenkamp</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hartskeerl</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>de Meza-Brewster</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Korver</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Terpstra</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>J Clin Micro</source>
            <pubdate>1994</pubdate>
            <volume>32</volume>
            <fpage>1894</fpage>
            <lpage>1898</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7989538</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2334/2/13/prepub</url>
         </p>
      </sec>
   </bm>
</art>
