<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2229-8-67</ui>
   <ji>1471-2229</ji>
   <fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>Synteny conservation between two distantly-related Rosaceae genomes: <it>Prunus </it>(the stone fruits) and <it>Fragaria </it>(the strawberry)</p>
			</title>
			<aug>
				<au id="A1">
					<snm>Vilanova</snm>
					<fnm>Santiago</fnm>
					<insr iid="I1"/>
					<insr iid="I3"/>
					<email>sanvina@upvnet.upv.es</email>
				</au>
				<au id="A2">
					<snm>Sargent</snm>
					<mi>J</mi>
					<fnm>Daniel</fnm>
					<insr iid="I2"/>
					<email>dan.sargent@emr.ac.uk</email>
				</au>
				<au id="A3">
					<snm>Ar&#250;s</snm>
					<fnm>Pere</fnm>
					<insr iid="I1"/>
					<email>pere.arus@irta.es</email>
				</au>
				<au id="A4" ca="yes">
					<snm>Monfort</snm>
					<fnm>Amparo</fnm>
					<insr iid="I1"/>
					<email>amparo.monfort@irta.es</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>IRTA. Centre de Recerca en Agrigen&#242;mica CSIC-IRTA-UAB, 08348 Cabrils, Spain</p>
				</ins>
				<ins id="I2">
					<p>East Malling Research (EMR), East Malling, Kent, ME19 6BJ, UK</p>
				</ins>
				<ins id="I3">
					<p>Universidad Polit&#233;cnica de Valencia, Centro de Conservaci&#243;n y Mejora de la Agrodiversidad Valenciana (COMAV), Spain</p>
				</ins>
			</insg>
			<source>BMC Plant Biology</source>
			<issn>1471-2229</issn>
			<pubdate>2008</pubdate>
			<volume>8</volume>
			<issue>1</issue>
			<fpage>67</fpage>
			<url>http://www.biomedcentral.com/1471-2229/8/67</url>
			<xrefbib>
				<pubidlist>
					<pubid idtype="pmpid">18564412</pubid>
					<pubid idtype="doi">10.1186/1471-2229-8-67</pubid>
				</pubidlist>
			</xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>31</day>
					<month>10</month>
					<year>2007</year>
				</date>
			</rec>
			<acc>
				<date>
					<day>18</day>
					<month>6</month>
					<year>2008</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>18</day>
					<month>6</month>
					<year>2008</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2008</year>
			<collab>Vilanova et al; licensee BioMed Central Ltd.</collab>
			<note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Background</p>
					</st>
					<p>The Rosaceae encompass a large number of economically-important diploid and polyploid fruit and ornamental species in many different genera. The basic chromosome numbers of these genera are <it>x </it>= 7, 8 and 9 and all have compact and relatively similar genome sizes. Comparative mapping between distantly-related genera has been performed to a limited extent in the Rosaceae including a comparison between <it>Malus </it>(subfamily Maloideae) and <it>Prunus </it>(subfamily Prunoideae); however no data has been published to date comparing <it>Malus </it>or <it>Prunus </it>to a member of the subfamily Rosoideae. In this paper we compare the genome of <it>Fragaria</it>, a member of the Rosoideae, to <it>Prunus</it>, a member of the Prunoideae.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>The diploid genomes of <it>Prunus </it>(<it>2n </it>= <it>2x </it>= 16) and <it>Fragaria </it>(<it>2n </it>= <it>2x </it>= 14) were compared through the mapping of 71 anchor markers &#8211; 40 restriction fragment length polymorphisms (RFLPs), 29 indels or single nucleotide polymorphisms (SNPs) derived from expressed sequence tags (ESTs) and two simple-sequence repeats (SSRs) &#8211; on the reference maps of both genera. These markers provided good coverage of the <it>Prunus </it>(78%) and <it>Fragaria </it>(78%) genomes, with maximum gaps and average densities of 22 cM and 7.3 cM/marker in <it>Prunus </it>and 32 cM and 8.0 cM/marker in <it>Fragaria</it>.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusion</p>
					</st>
					<p>Our results indicate a clear pattern of synteny, with most markers of each chromosome of one of these species mapping to one or two chromosomes of the other. A large number of rearrangements (36), most of which produced by inversions (27) and the rest (9) by translocations or fission/fusion events could also be inferred. We have provided the first framework for the comparison of the position of genes or DNA sequences of these two economically valuable and yet distantly-related genera of the Rosaceae.</p>
				</sec>
			</sec>
		</abs>
	</fm>
   <bdy>
		<sec>
			<st>
				<p>Background</p>
			</st>
			<p>Genome comparisons based on the map position of homologous markers between different plant taxa have established that the genomes of species within families of the Plant Kingdom, such as Solanaceae <abbrgrp>
					<abbr bid="B1">1</abbr>
					<abbr bid="B2">2</abbr>
				</abbrgrp>, Poaceae <abbrgrp>
					<abbr bid="B3">3</abbr>
				</abbrgrp>, Fabaceae <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp> and Brassicaceae <abbrgrp>
					<abbr bid="B5">5</abbr>
				</abbrgrp> differ in a limited number of chromosomal rearrangements, meaning that extensive chromosomal regions, and even entire chromosomes, are syntenic and colinear between different species <abbrgrp>
					<abbr bid="B6">6</abbr>
				</abbrgrp>. However, conservation of synteny is greatly reduced when comparisons are made between members of different families, as shown through the comparison of the genomes of several crop species with that of <it>Arabidopsis thaliana </it>
				<abbrgrp>
					<abbr bid="B7">7</abbr>
					<abbr bid="B8">8</abbr>
					<abbr bid="B9">9</abbr>
				</abbrgrp>.</p>
			<p>The Rosaceae encompass a large number (3,000) of diploid and polyploid species <abbrgrp>
					<abbr bid="B10">10</abbr>
				</abbrgrp> including important crops, such as those belonging to the genera <it>Prunus </it>(almond and all stone fruits: peach, apricot, cherry and plum), <it>Malus </it>(apple), <it>Pyrus </it>(pear), <it>Rosa </it>(rose), <it>Rubus </it>(raspberry) and <it>Fragaria </it>(strawberry). Their basic chromosome numbers are <it>x </it>= 7, 8 and 9 and all have a compact and relatively similar genome size that for diploid species ranges from ~170 Mbp in <it>Fragaria </it>(2n = 2x = 14) <abbrgrp>
					<abbr bid="B11">11</abbr>
				</abbrgrp> to ~300 Mbp in <it>Prunus </it>(2<it>n </it>= 2<it>x </it>= 16) <abbrgrp>
					<abbr bid="B12">12</abbr>
				</abbrgrp>. Most of the polyploid species within the family have a genome size approximately proportional to that of the diploid genomes from which they are composed, i.e. the amphidiploid apple (2<it>n </it>= 2<it>x </it>= 34) has a genome size of ~750 Mbp <abbrgrp>
					<abbr bid="B12">12</abbr>
				</abbrgrp> and the cultivated strawberry, an allo-octoploid (2<it>n </it>= 8<it>x </it>= 56), has a genome size of ~800 Mbp <abbrgrp>
					<abbr bid="B11">11</abbr>
				</abbrgrp>.</p>
			<p>Comparative mapping has been performed to a limited extent in the Rosaceae <abbrgrp>
					<abbr bid="B13">13</abbr>
				</abbrgrp>. The genus <it>Prunus</it>, from the subfamily Prunoideae, was the first to be studied, due to the existence of a high density reference map <abbrgrp>
					<abbr bid="B14">14</abbr>
					<abbr bid="B15">15</abbr>
				</abbrgrp>, based on a highly polymorphic interspecific (almond &#215; peach) F<sub>2 </sub>population and constructed with markers transferable to other species within the genus (mainly RFLPs and SSRs). The analysis of 16 published maps of <it>Prunus </it>species, each with at least 28 markers common to the reference map, established that the <it>Prunus </it>genome is essentially colinear and shared by all diploid species studied so far (peach, almond, apricot, cherry, myrobolan plum, <it>P. davidiana</it>, and <it>P. ferganenesis</it>) <abbrgrp>
					<abbr bid="B13">13</abbr>
				</abbrgrp>. Comparisons between the genomes of apple and pear, which belong to the subfamily Maloideae, indicate a very high level of synteny, and no major chromosomal rearrangements can be deduced from studies of common markers mapped in these genera <abbrgrp>
					<abbr bid="B16">16</abbr>
					<abbr bid="B17">17</abbr>
				</abbrgrp>. No data are currently published on synteny studies between members of the subfamily Rosoideae, which includes strawberry, rose and raspberry. There is however a partial comparison between the genomes of genera belonging to different sub-families: <it>Prunus </it>(Prunoideae) and <it>Malus </it>(Maloideae). This work was done with 34 markers (23 RFLPs and 11 isoenzymes) and, where comparisons were possible, a high level of synteny was detected, as well as at least one large-scale chromosomal rearrangement <abbrgrp>
					<abbr bid="B14">14</abbr>
				</abbrgrp>.</p>
			<p>In this paper we have compared the genomes of <it>Prunus </it>and <it>Fragaria</it>. For this purpose, we have used the previously mentioned <it>Prunus </it>reference map and the <it>Fragaria </it>reference map <abbrgrp>
					<abbr bid="B18">18</abbr>
				</abbrgrp>, which is based on an interspecific diploid <it>F. vesca </it>&#215; <it>F. nubicola </it>F<sub>2 </sub>population. The <it>Fragaria </it>map was constructed with mainly SSRs and markers derived from the growing information existing on expressed sequence tag (EST) sequences of different Rosaceae species, which are available through the Genome Database for the Rosaceae <abbrgrp>
					<abbr bid="B19">19</abbr>
				</abbrgrp>. Here, we have established a framework with common markers covering both genomes and found that in spite of the conservation of large chromosomal fragments, as expected from confamilial species, many chromosomal rearrangements separate the diploid <it>Fragaria </it>and <it>Prunus </it>genomes, supporting their distant position within the family deduced from DNA sequence data <abbrgrp>
					<abbr bid="B20">20</abbr>
				</abbrgrp>.</p>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<sec>
				<st>
					<p>
						<it>Fragaria </it>and <it>Prunus maps</it>
					</p>
				</st>
				<p>In total, 71 anchor markers were available for the comparison between the diploid genomes of <it>Prunus </it>and <it>Fragaria</it>. These were: a) 40 RFLPs from the same number of probes found polymorphic out of 65 single-copy probes already mapped in <it>Prunus </it>(Table <tblr tid="T1">1</tblr>), b) 13 <it>Fragaria </it>ESTs obtained after selecting from 135 of them highly homologous to <it>Prunus </it>mapped ESTs out of the 515 ESTs of the <it>Prunus </it>transcript map (Table <tblr tid="T2">2</tblr>); these markers were selected by their position on the map as they fell in regions not covered with RFLPs or that were judged to be of interest for the genome comparison, c) eight <it>Prunus </it>ESTs selected from 13 ESTs of the transcript map that did not have sequence homology with known <it>Fragaria </it>ESTs (Table <tblr tid="T2">2</tblr>), d) eight <it>Fragaria </it>STSs obtained from genes of known function previously mapped in <it>Fragaria </it>
					<abbrgrp>
						<abbr bid="B21">21</abbr>
					</abbrgrp> (Table <tblr tid="T2">2</tblr>), and e) two SSRs (Table <tblr tid="T2">2</tblr>).</p>
				<tbl id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>RFLP probes mapped in <it>Prunus </it>and <it>Fragaria </it>Single-copy RFLP probes mapped in <it>Prunus </it>and used for mapping in <it>Fragaria</it>. RFLP position in the <it>Prunus </it>and <it>Fragaria </it>maps and estimated copy number in <it>Fragaria</it>
						</p>
					</caption>
					<tblbdy cols="7">
						<r>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center" cspan="2">
								<p>
									<it>Prunus</it>
								</p>
							</c>
							<c ca="center" cspan="2">
								<p>
									<it>Fragaria</it>
								</p>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c cspan="2">
								<p/>
							</c>
							<c cspan="2">
								<hr/>
							</c>
							<c cspan="2">
								<hr/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Marker</p>
							</c>
							<c ca="left">
								<p>Accession No.</p>
							</c>
							<c ca="left">
								<p>LG<sup>a</sup>
								</p>
							</c>
							<c ca="left">
								<p>cM</p>
							</c>
							<c ca="left">
								<p>LG<sup>a</sup>
								</p>
							</c>
							<c ca="left">
								<p>cM</p>
							</c>
							<c ca="left">
								<p>Copy no.</p>
							</c>
						</r>
						<r>
							<c cspan="7">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG53</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023829</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>2.5</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>22.1</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC24</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203138</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>4.3</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>20.3</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG102</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023845</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>8.7</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>63.4</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC78</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203148</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>13.6</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>31.1</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC32</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203135</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>25.8</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG16</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023876</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>37</p>
							</c>
							<c ca="left">
								<p>+<sup>c</sup>
								</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC85</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.<sup>b</sup>
								</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>37</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC15</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203140</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>43</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG47</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023861</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>43.7</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>17.4</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC7</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>44</p>
							</c>
							<c ca="left">
								<p>++<sup>d</sup>
								</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG36</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023883</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>65.1</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>36.8</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC13</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203106</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>6</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC31</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203096</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>7.9</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC10</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203087</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>8.1</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>13.5</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC5</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203107</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>21</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG35</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023896</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>25</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>9</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC19</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203097</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>37</p>
							</c>
							<c ca="left">
								<p>++</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>MC045</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203117</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>38</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>81</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Ole1</b>
								</p>
							</c>
							<c ca="left">
								<p>X78118</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>39</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Omt1</b>
								</p>
							</c>
							<c ca="left">
								<p>X83217</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>47.6</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>89.6</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>CC125</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>49</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>MC115</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>++</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG13</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>6</p>
							</c>
							<c ca="left">
								<p>++</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG56</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>6.4</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>65.2</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG7</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023839</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>12</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>CC116</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>22</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>4.7</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>CC2</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203070</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>27.7</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>43.7</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>CC8</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203091</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>34.4</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>81.9</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG106</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023814</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>37.1</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>96</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>CC47</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203119</p>
							</c>
							<c ca="left">
								<p>PG4</p>
							</c>
							<c ca="left">
								<p>5.4</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>7.3</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG6</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023828</p>
							</c>
							<c ca="left">
								<p>PG4</p>
							</c>
							<c ca="left">
								<p>24.1</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>42.2</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG3</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023837</p>
							</c>
							<c ca="left">
								<p>PG4</p>
							</c>
							<c ca="left">
								<p>37.7</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>36.5</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC1</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203133</p>
							</c>
							<c ca="left">
								<p>PG4</p>
							</c>
							<c ca="left">
								<p>49.9</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>48.2</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PLG35</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>m<sup>e</sup>
								</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC49</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203072</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>15.2</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC14</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203132</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>20.6</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>19.1</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG33</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023821</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>49.1</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>56.4</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG13</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG54</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG40</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023810</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>5</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PLG59</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>5</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG215</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023827</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>8.7</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>36.5</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC50</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203094</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>17.5</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>48.2</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC8</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203052</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>34.5</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>61.2</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC21</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>56.4</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>72.8</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC73</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>64</p>
							</c>
							<c ca="left">
								<p>m</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC60</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>70</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Pgl1</b>
								</p>
							</c>
							<c ca="left">
								<p>X75020</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>74.3</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>22.8</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>LTP2</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>78</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC44</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203095</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>10.3</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>77.1</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC12</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>24.7</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>102.7</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>MC225</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203059</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>28.4</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>61.5</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG104</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023923</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>31.2</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>57</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>TSA3</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>52.9</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>39.3</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG42</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>59</p>
							</c>
							<c ca="left">
								<p>m</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG27</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023875</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>63</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>CC132</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203120</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>67.6</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>38.3</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG24</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023858</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>80</p>
							</c>
							<c ca="left">
								<p>++</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>EXT1</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>++</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>LY29</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023873</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>20.8</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>19.5</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC101</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203099</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>29.3</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>19.7</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>FG37</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023891</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>40.9</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>25.3</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AG49</b>
								</p>
							</c>
							<c ca="left">
								<p>BH023870</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>49.1</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>61.5</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>AC26</b>
								</p>
							</c>
							<c ca="left">
								<p>BI203074</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>52</p>
							</c>
							<c ca="left">
								<p>++</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Pru1</b>
								</p>
							</c>
							<c ca="left">
								<p>X78119</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>53.1</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>26.7</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>PC36</b>
								</p>
							</c>
							<c ca="left">
								<p>n.d.</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>60</p>
							</c>
							<c ca="left">
								<p>+</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>
							<sup>a</sup>LG = Linkage group in Fragaria (F) and Prunus (P)</p>
						<p>
							<sup>b</sup>n.d. = not determined</p>
						<p>
							<sup>c</sup>+ = no or weak hybridization</p>
						<p>
							<sup>d</sup>++ = complex banding pattern</p>
						<p>
							<sup>e</sup>m = monomorphic</p>
					</tblfn>
				</tbl>
				<tbl id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>Gene and EST-based markers mapped in <it>Prunus </it>and <it>Fragaria</it>.</p>
					</caption>
					<tblbdy cols="10">
						<r>
							<c/>
							<c ca="center" cspan="3">
								<p>
									<it>Prunus </it>
								</p>
							</c>
							<c ca="center" cspan="3">
								<p>
									<it>Fragaria </it>
								</p>
							</c>
							<c ca="center" cspan="3">
								<p>TBLASTX</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c cspan="3">
								<hr/>
							</c>
							<c cspan="3">
								<hr/>
							</c>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Locus</p>
							</c>
							<c ca="left">
								<p>Accession number</p>
							</c>
							<c ca="left">
								<p>LG<sup>a</sup>
								</p>
							</c>
							<c ca="left">
								<p>cM<sup>b</sup>
								</p>
							</c>
							<c ca="left">
								<p>
									<it/>Accession number</p>
							</c>
							<c ca="left">
								<p>LG<sup>a</sup>
								</p>
							</c>
							<c ca="left">
								<p>cM<sup>b</sup>
								</p>
							</c>
							<c ca="left">
								<p> E-value<sup>c</sup>
								</p>
							</c>
							<c ca="left">
								<p>Swissprot-homology<sup>d</sup>
								</p>
							</c>
							<c ca="left">
								<p>Marker<sup>e</sup>
								</p>
							</c>
						</r>
						<r>
							<c cspan="10">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvVB2119</p>
							</c>
							<c ca="left">
								<p>BU048565</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>4.3</p>
							</c>
							<c ca="left">
								<p>CX662119</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>22.5&#8211;43.2</p>
							</c>
							<c ca="left">
								<p>5,00E-49</p>
							</c>
							<c ca="left">
								<p>small GTP binding protein</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvVB2179</p>
							</c>
							<c ca="left">
								<p>BU046414</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>4.3</p>
							</c>
							<c ca="left">
								<p>CX662179</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>0.0&#8211;26.0</p>
							</c>
							<c ca="left">
								<p>2,00E-78</p>
							</c>
							<c ca="left">
								<p>Aldoketo-reductase</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvNH8894</p>
							</c>
							<c ca="left">
								<p>BU042720</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>40.5</p>
							</c>
							<c ca="left">
								<p>DV438894</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>53.9&#8211;73.8</p>
							</c>
							<c ca="left">
								<p>3.00E-84</p>
							</c>
							<c ca="left">
								<p>auxin-induced protein (Aux22)</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFaUF6868</p>
							</c>
							<c ca="left">
								<p>BU046817</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>48.0</p>
							</c>
							<c ca="left">
								<p>CO816868</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>53.9&#8211;73.8</p>
							</c>
							<c ca="left">
								<p>1.00E-109</p>
							</c>
							<c ca="left">
								<p>20S proteasome alpha 6 subunit</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFaTR1976</p>
							</c>
							<c ca="left">
								<p>BU039761</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>48.6</p>
							</c>
							<c ca="left">
								<p>CO381976</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>53.9&#8211;73.8</p>
							</c>
							<c ca="left">
								<p>2.00E-88</p>
							</c>
							<c ca="left">
								<p>Mannan endo-1.4-Beta-Mannosidase</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EKO</p>
							</c>
							<c ca="left">
								<p>AF495728</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>35.7&#8211;49.8</p>
							</c>
							<c ca="left">
								<p>AY462247</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>28.9</p>
							</c>
							<c ca="left">
								<p>8.00E-155</p>
							</c>
							<c ca="left">
								<p>Ent-kaurene oxidase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>DFR</p>
							</c>
							<c ca="left">
								<p>AB095030</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>35.7&#8211;49.8</p>
							</c>
							<c ca="left">
								<p>AY575057</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>70.5</p>
							</c>
							<c ca="left">
								<p>2.00E-106</p>
							</c>
							<c ca="left">
								<p>dihydroflavonol reductase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvVB1231</p>
							</c>
							<c ca="left">
								<p>BU046687</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>41.3</p>
							</c>
							<c ca="left">
								<p>CX661231</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>26.0&#8211;46.1</p>
							</c>
							<c ca="left">
								<p>5.00E-17</p>
							</c>
							<c ca="left">
								<p>RAD23-like</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU7308</p>
							</c>
							<c ca="left">
								<p>BU047308</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>75.2</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>26.7&#8211;45.8</p>
							</c>
							<c ca="left">
								<p>5.00E-27</p>
							</c>
							<c ca="left">
								<p>electron carrier/iron ion binding</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU9642</p>
							</c>
							<c ca="left">
								<p>BU039642</p>
							</c>
							<c ca="left">
								<p>PG1</p>
							</c>
							<c ca="left">
								<p>40.5</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>0.0&#8211;26.7</p>
							</c>
							<c ca="left">
								<p>4.00E-72</p>
							</c>
							<c ca="left">
								<p>ACT domain-containing protein</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFaUF7699</p>
							</c>
							<c ca="left">
								<p>BU040484</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>7.9</p>
							</c>
							<c ca="left">
								<p>CO817699</p>
							</c>
							<c ca="left">
								<p>FG4</p>
							</c>
							<c ca="left">
								<p>0.0&#8211;26.0</p>
							</c>
							<c ca="left">
								<p>1.00E-102</p>
							</c>
							<c ca="left">
								<p>Luminal Binding Protein BiP</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFaUF7084</p>
							</c>
							<c ca="left">
								<p>BU046792</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>24.3</p>
							</c>
							<c ca="left">
								<p>CO817084</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>63.4&#8211;81.0</p>
							</c>
							<c ca="left">
								<p>3.00E-96</p>
							</c>
							<c ca="left">
								<p>40 S ribosomal protein</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU2875</p>
							</c>
							<c ca="left">
								<p>BU042875</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>25.0</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>20.3</p>
							</c>
							<c ca="left">
								<p>4.00E-132</p>
							</c>
							<c ca="left">
								<p>RNA helicase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvNH8484</p>
							</c>
							<c ca="left">
								<p>BU041902</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>39.4</p>
							</c>
							<c ca="left">
								<p>DV438484</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>27.0&#8211;38.6</p>
							</c>
							<c ca="left">
								<p>5.00E-105</p>
							</c>
							<c ca="left">
								<p>GTP-Binding protein</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU9223</p>
							</c>
							<c ca="left">
								<p>BU039223</p>
							</c>
							<c ca="left">
								<p>PG2</p>
							</c>
							<c ca="left">
								<p>39.4</p>
							</c>
							<c ca="left">
								<p>DY672045</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>44.5</p>
							</c>
							<c ca="left">
								<p>1.00E-48</p>
							</c>
							<c ca="left">
								<p>6-phosphofructokinase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>ACO</p>
							</c>
							<c ca="left">
								<p>AF129073</p>
							</c>
							<c ca="left">
								<p>PG3</p>
							</c>
							<c ca="left">
								<p>35.0</p>
							</c>
							<c ca="left">
								<p>AY706156</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>83.1</p>
							</c>
							<c ca="left">
								<p>1.00E-165</p>
							</c>
							<c ca="left">
								<p>ACC oxydase</p>
							</c>
							<c ca="left">
								<p>SSR</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvVB2013</p>
							</c>
							<c ca="left">
								<p>BU039972</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>0.0</p>
							</c>
							<c ca="left">
								<p>CX662013</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>50.4&#8211;72.5</p>
							</c>
							<c ca="left">
								<p>6.00E-83</p>
							</c>
							<c ca="left">
								<p>Pectinacetylesterase precursor</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>ANS</p>
							</c>
							<c ca="left">
								<p>AB097216</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>15.2&#8211;21.0</p>
							</c>
							<c ca="left">
								<p>AY695818</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>9.7</p>
							</c>
							<c ca="left">
								<p>4.00E-143</p>
							</c>
							<c ca="left">
								<p>Anthocyanidin shynthase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>CEL-2</p>
							</c>
							<c ca="left">
								<p>AJ890498</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>21.7&#8211;40.7</p>
							</c>
							<c ca="left">
								<p>AF054615</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>29.2</p>
							</c>
							<c ca="left">
								<p>0.0</p>
							</c>
							<c ca="left">
								<p>endo-beta-1,4-glucanase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>AMPA112</p>
							</c>
							<c ca="left">
								<p>AY377916</p>
							</c>
							<c ca="left">
								<p>PG5</p>
							</c>
							<c ca="left">
								<p>4.1</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>FG5</p>
							</c>
							<c ca="left">
								<p>64.5</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>--</p>
							</c>
							<c ca="left">
								<p>SSR</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvNH9852</p>
							</c>
							<c ca="left">
								<p>BU040757</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>6.4</p>
							</c>
							<c ca="left">
								<p>DV439852</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>27.0&#8211;38.6</p>
							</c>
							<c ca="left">
								<p>1.00E-137</p>
							</c>
							<c ca="left">
								<p>60S Ribosomal Protein L10</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU9257</p>
							</c>
							<c ca="left">
								<p>BU039257</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>17.5</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>FG7</p>
							</c>
							<c ca="left">
								<p>24.9</p>
							</c>
							<c ca="left">
								<p>7.00E-109</p>
							</c>
							<c ca="left">
								<p>phosphoglucomutase precursor</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU1785</p>
							</c>
							<c ca="left">
								<p>BU041785</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>79.6</p>
							</c>
							<c ca="left">
								<p>DY669394</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>45.2&#8211;47.9</p>
							</c>
							<c ca="left">
								<p>1.00E-12</p>
							</c>
							<c ca="left">
								<p>SNF4 (Sucrose NonFermenting 4)</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU1830</p>
							</c>
							<c ca="left">
								<p>BU041830</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>79.6</p>
							</c>
							<c ca="left">
								<p>CX661290</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>14.1</p>
							</c>
							<c ca="left">
								<p>1.00E-132</p>
							</c>
							<c ca="left">
								<p>26s proteasome aaa-atpase subunit rpt5a</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>APX</p>
							</c>
							<c ca="left">
								<p>EE488129</p>
							</c>
							<c ca="left">
								<p>PG6</p>
							</c>
							<c ca="left">
								<p>4.1&#8211;24.9</p>
							</c>
							<c ca="left">
								<p>AF158654</p>
							</c>
							<c ca="left">
								<p>FG3</p>
							</c>
							<c ca="left">
								<p>49.5</p>
							</c>
							<c ca="left">
								<p>4.00E-102</p>
							</c>
							<c ca="left">
								<p>L-ascorbate peroxidase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFaUF7248</p>
							</c>
							<c ca="left">
								<p>BU043308</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>10.3</p>
							</c>
							<c ca="left">
								<p>CO817248</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>53.9&#8211;73.8</p>
							</c>
							<c ca="left">
								<p>1.00E-97</p>
							</c>
							<c ca="left">
								<p>Methionine synthase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EFvVB1923</p>
							</c>
							<c ca="left">
								<p>BU039764</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>29.6</p>
							</c>
							<c ca="left">
								<p>CX661923</p>
							</c>
							<c ca="left">
								<p>FG6</p>
							</c>
							<c ca="left">
								<p>56.5&#8211;68.1</p>
							</c>
							<c ca="left">
								<p>2.00E-73</p>
							</c>
							<c ca="left">
								<p>Enolase</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>EPpCU9910</p>
							</c>
							<c ca="left">
								<p>BU039910</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>64.7</p>
							</c>
							<c ca="left">
								<p>-</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>8.3</p>
							</c>
							<c ca="left">
								<p>1.00E-62</p>
							</c>
							<c ca="left">
								<p>putative ethanolamine kinase 1</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>F3H</p>
							</c>
							<c ca="left">
								<p>AB097151</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>42.5&#8211;47.8</p>
							</c>
							<c ca="left">
								<p>AB201760</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>40.6</p>
							</c>
							<c ca="left">
								<p>2.00E-178</p>
							</c>
							<c ca="left">
								<p>flavanone 3-hydroxylase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>PES</p>
							</c>
							<c ca="left">
								<p>X95991</p>
							</c>
							<c ca="left">
								<p>PG7</p>
							</c>
							<c ca="left">
								<p>49&#8211;56.1</p>
							</c>
							<c ca="left">
								<p>AY324809</p>
							</c>
							<c ca="left">
								<p>FG1</p>
							</c>
							<c ca="left">
								<p>33.7</p>
							</c>
							<c ca="left">
								<p>0.0</p>
							</c>
							<c ca="left">
								<p>Pectinesterase</p>
							</c>
							<c ca="left">
								<p>Indel</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>ADH</p>
							</c>
							<c ca="left">
								<p>BU573880</p>
							</c>
							<c ca="left">
								<p>PG8</p>
							</c>
							<c ca="left">
								<p>0.0&#8211;10.9</p>
							</c>
							<c ca="left">
								<p>X15588</p>
							</c>
							<c ca="left">
								<p>FG2</p>
							</c>
							<c ca="left">
								<p>17.9</p>
							</c>
							<c ca="left">
								<p>4.00E-101</p>
							</c>
							<c ca="left">
								<p>alcohol dehydrogenase</p>
							</c>
							<c ca="left">
								<p>SNP</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Gene or EST-based and SSR markers mapped in the <it>Prunus </it>and <it>Fragaria </it>genomes, with their accession numbers, map positions and homology with known proteins of other species.</p>
						<p>
							<sup>a </sup>LG = linkage group</p>
						<p>
							<sup>b </sup>Map position: If the marker was bin-mapped, the interval covered by the bin where the marker is located</p>
						<p>
							<sup>c </sup>E-value at NCBI database restricted to plant sequences</p>
						<p>
							<sup>d </sup>Predicted function</p>
						<p>
							<sup>e </sup>Marker type detected</p>
					</tblfn>
				</tbl>
				<p>Two mapping strategies were used in the placement of novel markers on both the T&#215;E and FV&#215;FN linkage maps (Table <tblr tid="T3">3</tblr>). For 55 markers: all 40 RFLPs, the eight <it>Fragaria </it>STSs, five of the <it>Fragaria </it>ESTs that displayed intron length polymorphisms and the two SSRs, were mapped by genotyping all individuals of the FV&#215;FN population. The 16 remaining markers were mapped using the bin mapping approach where a set of six plants (the bin set) permit wselective' or 'bin' mapping using the diploid strawberry mapping population <abbrgrp>
						<abbr bid="B22">22</abbr>
					</abbrgrp>. Only ten new markers were mapped in the T&#215;E population: the eight <it>Fragaria </it>ESTs were bin mapped <abbrgrp>
						<abbr bid="B15">15</abbr>
					</abbrgrp> and the two SSRs were mapped using the whole population.</p>
				<tbl id="T3">
					<title>
						<p>Table 3</p>
					</title>
					<caption>
						<p>Anchor markers used for map comparison. </p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="left">
								<p>Markers</p>
							</c>
							<c ca="left">
								<p>
									<it>Prunus </it>(T&#215;E)</p>
							</c>
							<c ca="left">
								<p>
									<it>Fragaria </it>(FV&#215;FN)</p>
							</c>
							<c ca="center">
								<p>No. anchor markers</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>RFLPs</p>
							</c>
							<c ca="left">
								<p>Mapped by Dirlewanger et al. (2004)</p>
							</c>
							<c ca="left">
								<p>Mapped<sup>a</sup>
								</p>
							</c>
							<c ca="center">
								<p>40</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>Fragaria </it>ESTs</p>
							</c>
							<c ca="left">
								<p>Mapped in the transcript map (GDR)</p>
							</c>
							<c ca="left">
								<p>Bin mapped<sup>a</sup>
								</p>
							</c>
							<c ca="center">
								<p>13</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>Fragaria </it>ESTs</p>
							</c>
							<c ca="left">
								<p>Bin mapped<sup>a</sup>
								</p>
							</c>
							<c ca="left">
								<p>Mapped by Sargent et al. (2007)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>Prunus </it>ESTs</p>
							</c>
							<c ca="left">
								<p>Mapped in the transcript map (GDR)</p>
							</c>
							<c ca="left">
								<p>Bin mapped (3)<sup>a </sup>or mapped (5)<sup>a</sup>
								</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Microsatellites</p>
							</c>
							<c ca="left">
								<p>Mapped<sup>a</sup>
								</p>
							</c>
							<c ca="left">
								<p>Mapped (1) by Sargent et al. (2007) or here (1)<sup>a</sup>
								</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Origin of the 71 anchor markers used for the comparison between the genomes of <it>Prunus </it>and diploid <it>Fragaria </it>using the reference populations (T&#215;E for <it>Prunus </it>and FV&#215;FN for <it>Fragaria</it>) and mapping strategies used: with the whole population ("mapped") or by bin mapping ("bin mapped").</p>
						<p>
							<sup>a</sup>Results obtained in this paper</p>
					</tblfn>
				</tbl>
				<p>The <it>Fragaria </it>map, constructed with MapMaker as described in the materials and methods, included 228 markers: 172 of the previous map <abbrgrp>
						<abbr bid="B18">18</abbr>
					</abbrgrp>, and 55 new markers studied here in the whole population. Three of the markers mapped in the map by Sargent et al. <abbrgrp>
						<abbr bid="B18">18</abbr>
					</abbrgrp>, CFVCT028, CFVCT05 and UFFxa03B05, could not be located using the conditions set for mapping in this work. The seven expected linkage groups (FG1&#8211;FG7) were detected, and the total genetic distance covered by the FV&#215;FN map was of 568.8 cM with an average density of 2.5 cM/marker and a ratio of 0.30 Mb/cM. The resulting map shows minor rearrangements in comparison to the original obtained by Sargent et al. <abbrgrp>
						<abbr bid="B18">18</abbr>
					</abbrgrp> most of which occurred in the upper part of the FG2. This map is presented in Additional file <supplr sid="S1">1</supplr>: 'FV&#215;FN reference map' that is included as supplementary information. The <it>Prunus </it>map included a total of 564 markers, the 562 described in <abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp> plus two SSRs mapped here. The map covers a distance of 511,3 cM with an average density of 0.91 cM/marker and a ratio of 0.59 Mb/cM.</p>
				<suppl id="S1">
					<title>
						<p>Additional file 1</p>
					</title>
					<text>
						<p>
							<b>FV&#215;FN reference map</b>. The diploid <it>Fragaria </it>reference map constructed using MapMaker from the data of Sargent et al. (2006) and the novel markers (boldface and red) added in this paper.</p>
					</text>
					<file name="1471-2229-8-67-S1.pdf">
						<p>Click here for file</p>
					</file>
				</suppl>
				<p>The distribution of the 71 anchor markers across the seven linkage groups of the strawberry genome was relatively even (Figure <figr fid="F1">1</figr>), ranging from seven markers on FG1 and FG5 to sixteen markers on FG2, with average marker densities ranging from 10.6 cM/marker on FG1 to 5.5 on FG2. The map distance covered by these markers was 441.3 cM, a 78% of the map constructed with all markers. Only three large gaps of >30 cM were observed, one at the end of FG3 (32.0 cM), one in the middle of FG2 (31.7 cM) and the longest on the lower part of FG7 (37.2 cM). The distribution of these 71 markers across the <it>Prunus </it>map was similar, with a maximum of 17 markers on PG1 and a minimum of four on PG4 and marker densities per linkage group ranging from 15.6 (PG4) to 5.0 (PG2) cM/marker. Map coverage with anchor markers was of 399.5 cM, a 78% of the complete map. Longest gaps between markers were smaller in <it>Prunus</it>, with only four exceeding 20 cM: 21.7 on PG7; 21.9 on PG6, 20.8 on PG8 and 28.6 on PG5. All the gaps on both the <it>Fragaria </it>and <it>Prunus </it>maps had at least one marker bin-mapped between the extreme markers of the gap, except for those on PG6 and FG3, suggesting that these were the longest gaps of each map.</p>
				<fig id="F1">
					<title>
						<p>Figure 1</p>
					</title>
					<caption>
						<p>
							<it>Prunus-Fragaria </it>map comparisons</p>
					</caption>
					<text>
						<p>
							<b>
								<it>Prunus-Fragaria </it>map comparisons</b>. Comparison between the maps of diploid <it>Fragaria </it>(FG1 to FG7) and <it>Prunus </it>(PG1 to PG8). Only common markers have been included in the framework of the reference maps of both genera. In parentheses after the markers is the distance from the origin of the linkage group to the marker for markers that have been mapped using the whole <it>Prunus </it>or <it>Fragaria </it>population. RFLP names are written in black and EST-derived markers in grey. The distance from the origin is not shown for markers that were bin-mapped, which are located within the region of the bin, indicated by a solid vertical bar at the corresponding locations on each of the linkage groups. Markers of one linkage group with correspondence in the other genome to linkage groups other than those that are in the neighbourhood have been indicated by the name of the corresponding group in parenthesis.</p>
					</text>
					<graphic file="1471-2229-8-67-1"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Map comparison between <it>Prunus </it>and <it>Fragaria</it>
					</p>
				</st>
				<p>The overall pattern of synteny is summarized in Figure <figr fid="F2">2</figr>, where it can be seen that the majority of linkage groups of either species have most markers in one or two linkage groups of the other. The simplest case is G5 of both species which have all markers in common, and the most complex is FG6 which contains markers from five different <it>Prunus </it>linkage groups, although most of the markers on this linkage group belong to PG3 and PG7. Considering only the <it>Prunus </it>linkage groups, five of them contain most or all markers from only one group of <it>Fragaria </it>(PG2-FG7, PG3-FG6, PG4-FG3, PG5-FG5 and PG8-FG2), and the other three of two groups (PG1-FG2 and FG4, PG6-FG1 and FG3, and PG7-FG1 and FG6).</p>
				<fig id="F2">
					<title>
						<p>Figure 2</p>
					</title>
					<caption>
						<p>
							<it>Prunus-Fragaria </it>synteny comparison</p>
					</caption>
					<text>
						<p>
							<b>
								<it>Prunus-Fragaria </it>synteny comparison</b>. Synteny between <it>Prunus </it>and <it>Fragaria</it>. Number of markers of each linkage group of one genus that correspond to the linkage groups in the other genus. Each marker is indicated by a black dot. Cells that contain three or more markers are noted with a grey background.</p>
					</text>
					<graphic file="1471-2229-8-67-2"/>
				</fig>
				<p>The presence of markers from two or more linkage groups of one species in a linkage group of the other would suggest that a fission/fusion, or a translocation event has taken place between the two species since their divergence from a common ancestor. Nine of these rearrangements would have taken place between the <it>Fragaria </it>and the <it>Prunus </it>genomes, based on our results.</p>
				<p>Colinearity of markers within syntenic regions of <it>Prunus </it>and <it>Fragaria </it>was only partial. The two most colinear groups FG5 and PG5 require only one inversion event to place all markers in the same order, but many more are required in other linkage groups. As shown in the materials and methods section, FG1 would require two inversions for the markers present on that linkage group to be in the same order as on PG7 and PG6 of <it>Prunus</it>, FG3 and FG4, three inversions, FG7 four inversions, FG6 six inversions and FG2 eight inversions. In total, at least 27 inversions are needed to account for the differences in the marker order of the two genomes. The estimated lower boundary of the total number of breakpoints that separate the <it>Fragaria </it>and <it>Prunus </it>genomes is thus 36 (nine translocations and 27 inversions).</p>
				<p>A scheme of the possible evolution of the <it>Fragaria </it>and <it>Prunus </it>genomes from a hypothetical ancestral genome of <it>x </it>= 9 <abbrgrp>
						<abbr bid="B23">23</abbr>
					</abbrgrp> is presented in Figure <figr fid="F3">3</figr>. In this scheme we have only considered the major chromosomal rearrangements, i.e. fusions/fissions and reciprocal translocations involving more than two of the markers used for the comparison. According to this scenario, the ancestral genome underwent two fusions (A5/A6 and A7/A8, corresponding to FG6 and FG1, respectively) and a reciprocal translocation between part of the A8 chromosome in FG1 and A9, which resulted in FG3, to become the <it>x </it>= 7 strawberry genome. For the <it>Prunus x </it>= 8 genome, the ancestral genome was submitted to three fusions, A1/A2 to form PG1, A6/A7 to form PG7 and A8/A9 to form PG6 and two fissions, part of A1 in the A1/A2 chromosome to form PG8 and part of A9 in the A8/A9 chromosome to form PG4.</p>
				<fig id="F3">
					<title>
						<p>Figure 3</p>
					</title>
					<caption>
						<p>Scheme of the evolution of <it>Prunus </it>and <it>Fragaria </it>chromosomes from an ancestral genome</p>
					</caption>
					<text>
						<p>
							<b>Scheme of the evolution of <it>Prunus </it>and <it>Fragaria </it>chromosomes from an ancestral genome</b>. Model of evolution of <it>Prunus </it>(PG1&#8211;PG8) and <it>Fragaria </it>(FG1&#8211;FG7) chromosomes from a hypothetical ancestral Rosaceae genome with <it>x </it>= 9 chromosomes (A1&#8211;A9). Only major chromosomal rearrangements (fusion/fission or translocation events involving more than two common markers between the two genomes) have been considered.</p>
					</text>
					<graphic file="1471-2229-8-67-3"/>
				</fig>
				<p>Some inferences about the evolution of certain chromosomes can be formulated based on the comparison between the two maps (Figure <figr fid="F1">1</figr>), the proposed evolution of both genomes from an ancestral one (Figure <figr fid="F3">3</figr>), and the limited information available on cytogenetics and map comparison of the Rosaceae. The simplest comparison is that of FG5 and PG5, which display remarkable levels of structural conservation, the marker order between <it>Prunus </it>and <it>Fragaria </it>differing by just a single inversion event. Most markers of FG7 and PG2 are in common, suggesting their origin from a single ancestral chromosome (A4), but FG7 includes a short fragment of PG6, and PG2 is not completely included in FG7, with a small region being located on FG4. PG1 is a long linkage group that contains many more markers than the rest and that is likely to coincide with chromosome 1 of <it>Prunus </it>
					<abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp>, which is clearly longer than the other chromosomes of this genus <abbrgrp>
						<abbr bid="B24">24</abbr>
					</abbrgrp>. Based on karyotype observations, such a long chromosome does not exist in <it>Malus </it>
					<abbrgrp>
						<abbr bid="B25">25</abbr>
					</abbrgrp> or in <it>Fragaria </it>
					<abbrgrp>
						<abbr bid="B26">26</abbr>
					</abbrgrp>. The map comparison between <it>Malus </it>and <it>Prunus </it>
					<abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp> provided additional evidence that the long <it>Prunus </it>chromosome may be split into two in at least one of the constituent genomes of the amphidiploid <it>Malus </it>chromosome complement. Our data suggest that PG1 arose from the fusion of two ancestral chromosomes, A1 and A2, which correspond to FG4 and FG2, respectively, in strawberry. The region of PG1 where the fission/fusion occurred in the <it>Prunus</it>-apple comparison (38&#8211;44 cM from the top of PG1) is also compatible with that of the <it>Prunus</it>-<it>Fragaria </it>(estimated to be in the region of 25&#8211;45 cM from the top of PG1). Interestingly, most of PG8, one of the <it>Prunus </it>chromosomes with the fewest number of markers and with the smallest genetic distance, appears to be integrated into FG2, with five of the six anchor markers studied being in the same order in PG8 and FG2. This situation may be the result of the fission of A1 in <it>Prunus </it>but not in <it>Fragaria</it>.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st>
			<p>The comparison between the maps of <it>Prunus </it>and diploid <it>Fragaria </it>has been performed with 71 common markers. Most of them were mapped already in the <it>Prunus </it>map and were added to the strawberry map here. These markers resulted in good coverage of both genomes: 78% of the total distance of the reference maps of both <it>Prunus </it>
				<abbrgrp>
					<abbr bid="B14">14</abbr>
				</abbrgrp> and strawberry <abbrgrp>
					<abbr bid="B18">18</abbr>
				</abbrgrp>. The average density of anchor markers was of 7.3 cM/marker with a maximum gap of 22 cM (in PG6) for <it>Prunus </it>and 8.0 cM/marker and a maximum gap of 32 cM (in FG3) for <it>Fragaria</it>. The total map distance of the <it>Prunus </it>(519 cM) and the <it>Fragaria </it>(569 cM) maps were similar when constructed with all markers available <abbrgrp>
					<abbr bid="B14">14</abbr>
					<abbr bid="B18">18</abbr>
				</abbrgrp>. Given that the genome size of <it>Prunus </it>is approximately twice that of strawberry these results suggest that the overall recombination rate per physical unit distance for the <it>Fragaria </it>FV&#215;FN hybrid was higher than for the almond &#215; peach F<sub>1 </sub>individual that generated the T&#215;E F<sub>2 </sub>population.</p>
			<p>For the comparison between the two genomes, we selected 65 RFLP probes, all from <it>Prunus </it>or <it>Malus </it>species, which produced good hybridization and were single copy in the <it>Prunus </it>genome. These probes were studied in strawberry with the same stringency conditions as in <it>Prunus </it>and 16 (24%) produced poor or no hybridization, suggesting that they were not present in the strawberry genome or that their sequences differed substantially from those of <it>Prunus</it>. Some of the probes that did not hybridize were located together in the same regions of the <it>Prunus </it>genome where several probes covering short genetic distances (&lt;10 cM per region) did not hybridize, such as the central region of PG1 and the upper extreme of PG6 (Table <tblr tid="T1">1</tblr>). The three probes that did not hybridize in the PG1 region were two from a peach cDNA library (PC85 and PC15) and one from a genomic library of <it>P. ferganensis </it>(FG16). Two of them (PC15 and FG16) were sequenced (Table <tblr tid="T1">1</tblr>) and had homology with known proteins. The region of PG6 had four markers (AG13, AG54, AG40 and PLG59), all of them from <it>Prunus </it>genomic libraries. Only AG40 was sequenced and its sequence had no homology with protein sequences. These results suggest that the corresponding regions, or at least the specific sequences tested, may be deleted in the strawberry genome. Given that some of the probes are homologous to proteins that are usually present as gene families such as polygalacturonase (FG16) and defensin protein 1 (PC15), an alternative explanation is that they may correspond to copies of these genes with high sequence divergence from those present in strawberry.</p>
			<p>From the 40 RFLP probes that produced good hybridization and that were polymorphic, 14 (35%) detected two loci in strawberry, whilst in <it>Prunus </it>they were single-locus (Table <tblr tid="T1">1</tblr>). Tanksley et al. <abbrgrp>
					<abbr bid="B27">27</abbr>
				</abbrgrp> found that five (12%) of the 42 tomato cDNA probes which they mapped in pepper had a different number of copies in each species. These differences in copy number may be due to differential deletions of duplicated DNA fragments existing in the ancestral genome from which <it>Prunus </it>and <it>Fragaria </it>originate. The presence of these duplications complicates the genome comparison because, if only one locus of the two can be mapped, as with the RFLPs mapped here in <it>Fragaria</it>, in half of the cases, the position of the marker could be interpreted as the presence of a spurious genetic rearrangement.</p>
			<p>The number of RFLPs mapped in T&#215;E that were single copy, detected with Rosaceae probes, segregated in the strawberry population and had a good distribution along the <it>Prunus </it>map, was insufficient for a good coverage of the <it>Prunus </it>genome. This was due in part to the fact that approximately half of the probes used for RFLP mapping in <it>Prunus </it>have more than one copy <abbrgrp>
					<abbr bid="B28">28</abbr>
					<abbr bid="B29">29</abbr>
				</abbrgrp> and that a substantial number of probes used in T&#215;E (30%) come from families other than the Rosaceae <abbrgrp>
					<abbr bid="B14">14</abbr>
				</abbrgrp>. To solve this problem, we used the available EST and physical map information in <it>Prunus </it>to find ESTs placed in most of the uncovered regions. We then mapped these ESTs by an efficient and expensive approach, resequencing, using a cheap mapping strategy, bin mapping. This allowed us to cover most gaps of the <it>Prunus </it>genome and to reduce the maximum gap without anchor markers in this species to 22 cM. Given the fast rate of growth of the information on the <it>Prunus </it>transcript map, this strategy is likely to allow us a more detailed analysis of synteny in the near future.</p>
			<p>Figure <figr fid="F2">2</figr> shows that the level of synteny between <it>Prunus </it>and <it>Fragaria </it>is high, with most of the markers that mapped to the same linkage group in one species mapping to one or two linkage groups in the other. However, the colinearity is only partial, with an estimated number of nine chromosomal rearrangements involving two chromosomes (translocations or fusion/fission events) and 27 inversions. The number of translocations and fusion/fission events is high if we compare it with other confamilial comparisons where this number has been estimated. Only the distant Solanaceae genomes of pepper and tomato, with 10 of these rearrangements estimated <abbrgrp>
					<abbr bid="B30">30</abbr>
				</abbrgrp>, yielded similar results. However, the predominance of inversions over other rearrangements that we found in the <it>Prunus</it>-<it>Fragaria </it>genome comparison is frequent in the Plant Kingdom, such as in the comparisons between tomato and potato <abbrgrp>
					<abbr bid="B31">31</abbr>
				</abbrgrp>, tomato and eggplant <abbrgrp>
					<abbr bid="B2">2</abbr>
				</abbrgrp>, tomato and pepper <abbrgrp>
					<abbr bid="B30">30</abbr>
				</abbrgrp>, <it>Brassica nigra </it>and <it>Arabidopsis thaliana </it>
				<abbrgrp>
					<abbr bid="B32">32</abbr>
				</abbrgrp> or a. <it>thaliana </it>and <it>A. lyrata </it>
				<abbrgrp>
					<abbr bid="B33">33</abbr>
				</abbrgrp>.</p>
			<p>The centromeres or heterochromatic regions around the centromeres are often where breakpoints occur, leading to chromosomal rearrangements. Most inversions and translocations in the Solanaceae <abbrgrp>
					<abbr bid="B30">30</abbr>
					<abbr bid="B34">34</abbr>
				</abbrgrp> and Poaceae <abbrgrp>
					<abbr bid="B35">35</abbr>
				</abbrgrp> had their breakpoints at or near the centromere. This information may be useful to deduce the position of the centromeres of some of the <it>Prunus </it>or <it>Fragaria </it>chromosomes. For example, based on the position where we hypothesize that a fusion event occurred between ancestral chromosomes A1 and A2 to form PG1, we may infer that the centromere is located in the central part of this chromosome (30&#8211;45 cM from the top). This is consistent with the metacentric nature of peach chromosome 1. Schubert <abbrgrp>
					<abbr bid="B36">36</abbr>
				</abbrgrp> proposed a model for chromosome fusion where a reciprocal translocation between an acrocentric or telocentric chromosome and another chromosome may generate a larger fused chromosome plus a small chromosome that is eventually lost. Following this model, one of FG2, FG4 or both, or their ancestral chromosomes (A1 and A2), was probably acrocentric. Other metacentric chromosomes may be those that are composed of parts (possibly entire translocated arms) of two chromosomes of the other species; this may be the case of PG7, PG6, FG1, FG6 and FG3 (see Figure <figr fid="F3">3</figr>). In the case of PG6, a reciprocal translocation with PG8 was previously reported in peach <abbrgrp>
					<abbr bid="B37">37</abbr>
				</abbrgrp>. The breakpoint was estimated to be located in the region of 18&#8211;39 cM from the top of PG6, which coincides with the region of junction between the fragments of FG1 and FG3 (18&#8211;35 cM) and may correspond to centromeric regions of these three chromosomes. On the other hand, the translocation breakpoint of PG8 <abbrgrp>
					<abbr bid="B37">37</abbr>
				</abbrgrp> is located in its distal region, suggesting that it is an acrocentric chromosome.</p>
			<p>A rate of 0.14(&#177; 0.06) structural mutations per chromosome per million years (My) of divergence was estimated <abbrgrp>
					<abbr bid="B6">6</abbr>
				</abbrgrp> from the analysis of various macrosynteny comparisons in plants. Considering this rate, our estimation of a number of at least 36 chromosomal rearrangements between <it>Prunus </it>and <it>Fragaria</it>, assuming that the initial number of chromosomes of the common ancestor was <it>x </it>= 9, allows us to estimate that the divergence of these two species dates from approximately 29 Mya. This places these two genera as distant taxa within the Rosaceae, similar to maize and sorghum in the Poaceae (~24 Mya) but closer than tomato and pepper in the Solanaceae (~40 Mya), maize and rice or wheat and rice, both with an estimated divergence time of ~66 Mya <abbrgrp>
					<abbr bid="B6">6</abbr>
				</abbrgrp>.</p>
			<p>Our results indicate that there is sufficient synteny between the genomes of <it>Fragaria </it>and <it>Prunus </it>to allow the information on marker or gene or quantitative trait locus (QTL) position from one of these species to be used in the other. For example, the gene that determines the ability to produce runners (vegetative propagules) in strawberry (<it>R</it>/<it>r</it>) is located on FG2 at a position syntenic to the region of PG1 where the Evergrowing gene (<it>Evg</it>/<it>evg</it>) that determines continuous leaf production <abbrgrp>
					<abbr bid="B38">38</abbr>
				</abbrgrp> and a QTL that determines blooming time in peach are located <abbrgrp>
					<abbr bid="B39">39</abbr>
				</abbrgrp>. The gene for seasonal vs. perpetual flowering in strawberry (<it>S</it>/<it>s</it>) maps to a region of FG6 (proximal to the SSR EMFn017), that in our comparison roughly coincides with a PG7 fragment where a major QTL determining blooming time in peach lies <abbrgrp>
					<abbr bid="B39">39</abbr>
				</abbrgrp>. These comparisons are however preliminary and need to be studied in more detail, but are a first insight into other possible comparisons that may facilitate the advancement on the knowledge of the genetics of key characters of the Rosaceae.</p>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>Whilst the economical importance of peach and its relatively easy manipulation (shorter intergeneration period and self-compatibility) compared to other fruit tree species have determined that many genes have been studied <abbrgrp>
					<abbr bid="B40">40</abbr>
				</abbrgrp> and that the position of at least 28 of them has been established on the <it>Prunus </it>map <abbrgrp>
					<abbr bid="B14">14</abbr>
				</abbrgrp>, the diploid strawberry has important advantages, i.e., a genome of a size similar to that of Arabidopsis, ease of genetic transformation, and a rapid life-cycle. In addition, the plants are small, and produce a large number of seed per cross, and thus diploid strawberry may become a very efficient organism for reverse genetics and other genomics applications that may provide useful information for other Rosaceous species, particularly fruit tree crops <abbrgrp>
					<abbr bid="B41">41</abbr>
				</abbrgrp>. This will be facilitated by the information on map comparisons between these two genera that we present in this paper.</p>
		</sec>
		<sec>
			<st>
				<p>Methods</p>
			</st>
			<sec>
				<st>
					<p>Plant material</p>
				</st>
				<p>The parents and progeny of two mapping populations were used for comparing the <it>Prunus </it>and <it>Fragaria </it>genomes, those of the F<sub>2</sub>interspecific <it>Prunus </it>reference mapping population (N = 82) derived from the F<sub>1 </sub>cross between the almond (<it>P. dulcis</it>) cultivar 'Texas' and the peach (<it>P. persica</it>) cultivar 'Earlygold' (abbreviated T&#215;E) and the F<sub>2 </sub>interspecific diploid <it>Fragaria </it>reference mapping population (N = 76) derived from the F<sub>1 </sub>cross of <it>F. vesca </it>815 &#215; <it>F. nubicola </it>601 (abbreviated FV&#215;FN). The T&#215;E map is composed of 562 markers (185 SSRs, 361 RFLPs, 11 isoenzymes and 5 STSs) <abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp>, whilst the FV&#215;FN map currently consists of 182 markers (175 SSRs, 6 gene specific markers and 1 SCAR) <abbrgrp>
						<abbr bid="B18">18</abbr>
					</abbrgrp>. Most markers used were selected from T&#215;E and subsequently mapped in FV&#215;FN.</p>
			</sec>
			<sec>
				<st>
					<p>DNA extraction</p>
				</st>
				<p>For <it>Fragaria</it>, one gram of young expanding leaves of each individual was collected and kept at -80&#176;C before DNA isolation. Genomic DNA was isolated from the leaf samples using the CTAB method of Doyle and Doyle <abbrgrp>
						<abbr bid="B42">42</abbr>
					</abbrgrp>, followed by DNeasy miniprep kit purification (Qiagen). DNA concentrations were measured using a Gene Quant II spectrophotometer (Pharmacia Biotech). For <it>Prunus</it>, DNA was extracted as described in <abbrgrp>
						<abbr bid="B28">28</abbr>
					</abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>RFLP markers</p>
				</st>
				<p>A total of 65 probes from various <it>Prunus </it>species and apple were used for RFLP analysis (Table <tblr tid="T1">1</tblr>). These probes were selected from those used in the construction of the <it>Prunus </it>reference map <abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp> to be single-copy and covering the whole genome at approximately even distances of 10&#8211;25 cM. RFLP analysis was performed with the procedure of Viruel et al. <abbrgrp>
						<abbr bid="B28">28</abbr>
					</abbrgrp>. DNA probes were first hybridized in the parents of the FV&#215;FN population and those that detected RFLPs were studied later in all F<sub>2 </sub>individuals.</p>
			</sec>
			<sec>
				<st>
					<p>Markers based on <it>Fragaria </it>or <it>Prunus </it>ESTs</p>
				</st>
				<p>An additional set of markers was developed from the <it>Prunus </it>transcript map, i.e. the collection of EST unigenes that are located on the same BAC or the same BAC contig of the peach physical map as mapped markers (usually RFLPs) of the reference linkage map <abbrgrp>
						<abbr bid="B43">43</abbr>
					</abbrgrp>. We analysed 515 T&#215;E ESTs currently anchored in the <it>Prunus </it>transcript map (found in the Genome Database for Rosaceae) to find homologous EST sequences in <it>Fragaria </it>by using the TBLASTX program <abbrgrp>
						<abbr bid="B44">44</abbr>
					</abbrgrp>. The selected sequences (only sequences with an e-value &lt;1.00E-15) (Table <tblr tid="T2">2</tblr>) were then analyzed with TBLASTN, and the most homologous regions were selected for primer design. Primers were designed to include putative <it>Fragaria </it>introns based on the Arabidopsis genome sequence <abbrgrp>
						<abbr bid="B45">45</abbr>
					</abbrgrp> and to give an expected amplicon size >800 bp, using the program Primer3 <abbrgrp>
						<abbr bid="B46">46</abbr>
					</abbrgrp>.</p>
				<p>For SNP detection, <it>Fragaria </it>ESTs were PCR-amplified in the parents of the <it>Fragaria </it>mapping population in a temperature-gradient PCR to obtain the optimum annealing temperature for each EST primer pair. The PCR reactions were performed as described in <abbrgrp>
						<abbr bid="B47">47</abbr>
					</abbrgrp> and amplification products were sequenced with an ABI PRISM 3700 DNA Analyzer and SNPs were detected between the two parental lines through sequence alignment using the STADEN package <abbrgrp>
						<abbr bid="B48">48</abbr>
					</abbrgrp> and verified by visual inspection of the DNA chromatograms. The same procedure was followed for <it>Prunus </it>ESTs of the transcript map for which we did not find homologous <it>Fragaria </it>ESTs.</p>
				<p>The sequences of the primers used for the development of these markers can be found in Table <tblr tid="T4">4</tblr>. The terminology used for the EST derived markers was: E (for EST), a two letter code for the species where the EST was obtained (Fv, Fa or Pp for <it>F. vesca</it>, <it>F. x ananassa </it>and <it>P. persica</it>, respectively), two additional letters for the place where the EST was obtained (i.e. NH for University of New Hampshire, VB for Virginia Bioinformatics Institute, UF for University of Florida, TR for Trisaia Research Center and CU for Clemson University) and four numbers that correspond to the last four digits of the EST EMBL accession number.</p>
				<tbl id="T4">
					<title>
						<p>Table 4</p>
					</title>
					<caption>
						<p>Gene and EST-based marker primer sequences. Primers used for DNA amplification in the markers obtained from <it>Fragaria </it>gene or EST or <it>Prunus </it>EST sequences.</p>
					</caption>
					<tblbdy cols="5">
						<r>
							<c ca="left">
								<p>Origin</p>
							</c>
							<c ca="left">
								<p>Locus name</p>
							</c>
							<c ca="left">
								<p>Forward primer sequence 5' &#8211; 3'</p>
							</c>
							<c ca="left">
								<p>Reverse primer sequence 5' &#8211; 3'</p>
							</c>
							<c ca="left">
								<p>Reference<sup>a</sup>
								</p>
							</c>
						</r>
						<r>
							<c cspan="5">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>Fragaria </it>gene</p>
							</c>
							<c ca="left">
								<p>EKO</p>
							</c>
							<c ca="left">
								<p>ACAGTCCAGCTCCAATAGTTCC</p>
							</c>
							<c ca="left">
								<p>GCTTTCCCATTGATTCTTGTCC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="AY462247">AY462247</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>F3H</p>
							</c>
							<c ca="left">
								<p>GAGTTGATACCAAGCTCATCTCG</p>
							</c>
							<c ca="left">
								<p>GTCACCTCTCTCCATCCTTCC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="AB097151">AB097151</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>DFR</p>
							</c>
							<c ca="left">
								<p>CCACTCCTATGGATTTTGAGTCC</p>
							</c>
							<c ca="left">
								<p>CTAGCACCCCATTTATTGTTGG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="AB095030">AB095030</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>ADH</p>
							</c>
							<c ca="left">
								<p>GCKTCAMGAATTATYGGKGTTG</p>
							</c>
							<c ca="left">
								<p>ATGGGASTTKRTGGGTGATG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="X15588">X15588</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>Fragaria </it>EST</p>
							</c>
							<c ca="left">
								<p>EFvVB2179</p>
							</c>
							<c ca="left">
								<p>ATCTGCGTGACAATGCAAAG</p>
							</c>
							<c ca="left">
								<p>AAGAGCCTTCAGTTGCTCCA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CX662179">CX662179</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvVB2119</p>
							</c>
							<c ca="left">
								<p>GCTCGAGCTGATTACGATTACC</p>
							</c>
							<c ca="left">
								<p>TAAAGGACCCATCAGAGAAACG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CX662119">CX662119</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvNH8894</p>
							</c>
							<c ca="left">
								<p>GGTTAGGTCTCCCCAGTGGT</p>
							</c>
							<c ca="left">
								<p>GGACGTCTCCCACTAGCATC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="DV438894">DV438894</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvVB1231</p>
							</c>
							<c ca="left">
								<p>CCAACTGTGACATCCACGAC</p>
							</c>
							<c ca="left">
								<p>GCTGTCACGCAGAAAATCAA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CX661231">CX661231</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFaUF6868</p>
							</c>
							<c ca="left">
								<p>GCTCTTCCAGGTCGAGTACG</p>
							</c>
							<c ca="left">
								<p>GTTTCCACTTGGGCAGTTGT</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CO816868">CO816868</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFaTR1976</p>
							</c>
							<c ca="left">
								<p>GTTGGTGCTGAGTTTGGTGA</p>
							</c>
							<c ca="left">
								<p>CCCAACTGCTCAAGAAGGAG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CO381976">CO381976</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFaUF7699</p>
							</c>
							<c ca="left">
								<p>GTTCTTGTTGGTGGAAGCAC</p>
							</c>
							<c ca="left">
								<p>CCTCAAAGACCTGAATGGAG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CO817699">CO817699</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFaUF7084</p>
							</c>
							<c ca="left">
								<p>CAGAAGAGGTTCAAGTTCC</p>
							</c>
							<c ca="left">
								<p>ACACCATAGCAAGCCCTG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CO817084">CO817084</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvNH8484</p>
							</c>
							<c ca="left">
								<p>TTCTGGTGTCGGCAAGTC</p>
							</c>
							<c ca="left">
								<p>AGGCCTGCTCAACATTGG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="DV438484">DV438484</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvVB2013</p>
							</c>
							<c ca="left">
								<p>GTGCAGTTGCCAAAGGAGC</p>
							</c>
							<c ca="left">
								<p>AGCTGGGTTTGCTGCTT</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CX662013">CX662013</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvNH9852</p>
							</c>
							<c ca="left">
								<p>TTCTGTCGTGGTGTCCC</p>
							</c>
							<c ca="left">
								<p>ATGATCTTTTGGCGACCA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="DV439852">DV439852</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFvNH7822</p>
							</c>
							<c ca="left">
								<p>GATGCTGGGTCTGCTGGG</p>
							</c>
							<c ca="left">
								<p>GCCTGCTCATTGGCATA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CO817822">CO817822</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFaUF7248</p>
							</c>
							<c ca="left">
								<p>ACTGCTCGCCCAATGAAG</p>
							</c>
							<c ca="left">
								<p>TCACATCAGCATCCATGTCA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CO817248">CO817248</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EFavB1923</p>
							</c>
							<c ca="left">
								<p>GGCCGTGTCTCTTGCAGT</p>
							</c>
							<c ca="left">
								<p>TGGGAGCAAATCCACCTT</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="CX661923">CX661923</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>ACO</p>
							</c>
							<c ca="left">
								<p>AGCACCTTCTACCTCAAACACC</p>
							</c>
							<c ca="left">
								<p>CTCACAGAACAAGTCCAAGAGC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="AF129073">AF129073</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>Prunus </it>EST</p>
							</c>
							<c ca="left">
								<p>EPpCU9642</p>
							</c>
							<c ca="left">
								<p>TTCAGTTGGCAGATCCTGTG</p>
							</c>
							<c ca="left">
								<p>TGCTGAGACCCTTCCAATTT</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU039642">BU039642</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU1785</p>
							</c>
							<c ca="left">
								<p>TTTTCCAAACCTTGCTGGAG</p>
							</c>
							<c ca="left">
								<p>GCAGTAGCTGTGGCAATGAA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU041785">BU041785</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU7308</p>
							</c>
							<c ca="left">
								<p>GGCAGGCCGCTCTTATACTA</p>
							</c>
							<c ca="left">
								<p>GACTCTTTTCGGGGTTCCA</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU047308">BU047308</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU9257</p>
							</c>
							<c ca="left">
								<p>CACCACCGTTTCAAAAGAGG</p>
							</c>
							<c ca="left">
								<p>CTGAAGCTCTAGCTGAGGCAAG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU039257">BU039257</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU1830</p>
							</c>
							<c ca="left">
								<p>TGATGCAATTGGCACAAAGC</p>
							</c>
							<c ca="left">
								<p>CCTATCACCACTTACTTCACTGC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU041830">BU041830</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU9910</p>
							</c>
							<c ca="left">
								<p>ATAACTCTGCCATCCGAATCC</p>
							</c>
							<c ca="left">
								<p>CATTCCTTGAACAGATCCTTGC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU039910">BU039910</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU9223</p>
							</c>
							<c ca="left">
								<p>AACAGAGCCAAGCTTATGCAG</p>
							</c>
							<c ca="left">
								<p>TTTCTGCGCAACCGCATC</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU039223">BU039223</ext-link>
								</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>EPpCU2875</p>
							</c>
							<c ca="left">
								<p>AACTCAGAGACATATCTGCACAGG</p>
							</c>
							<c ca="left">
								<p>AAGTTGAAGCGGTCTTCATAGG</p>
							</c>
							<c ca="left">
								<p>
									<ext-link ext-link-type="embl" ext-link-id="BU042875">BU042875</ext-link>
								</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>
							<sup>a</sup>EMBL accession numbers for the sequences from which novel primer pairs were designed</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>
						<it>Fragaria </it>gene-specific markers</p>
				</st>
				<p>Eight further gene specific loci that had previously been mapped in the FV&#215;FN population <abbrgrp>
						<abbr bid="B21">21</abbr>
					</abbrgrp> were mapped in the T&#215;E population. The primer pairs used for amplification of four of these genes (CEL-2, PES, ANS and APX) were previously described by Sargent et al. <abbrgrp>
						<abbr bid="B21">21</abbr>
					</abbrgrp> whilst primer pairs for the remaining four (EKO, F3H, DFR and ADH) were designed following the procedures of Sargent et al. <abbrgrp>
						<abbr bid="B21">21</abbr>
					</abbrgrp> from gene sequences deposited in the EMBL database and are listed in Table <tblr tid="T4">4</tblr>. The primer pairs were used to amplify products from the parents of the <it>Prunus </it>mapping population following the procedure of Sargent et al. <abbrgrp>
						<abbr bid="B47">47</abbr>
					</abbrgrp> and SNPs were detected as described above.</p>
			</sec>
			<sec>
				<st>
					<p>Microsatellite markers</p>
				</st>
				<p>One SSR (ACO) developed in the 5' UTR of <it>Prunus </it>1-aminocyclopropane-1-carboxylate oxidase gene (ACC oxidase; AF129073) was used to locate this gene, which was already mapped in <it>Fragaria </it>
					<abbrgrp>
						<abbr bid="B21">21</abbr>
					</abbrgrp>, onto the T&#215;E map. The primers used are listed in Table <tblr tid="T4">4</tblr>. Another apricot SSR, AMPA112, previously described by Hagen et al. <abbrgrp>
						<abbr bid="B49">49</abbr>
					</abbrgrp>, was polymorphic in both reference populations and was also included in the map comparison. PCR reactions were performed as described by <abbrgrp>
						<abbr bid="B50">50</abbr>
					</abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Map construction in <it>Fragaria </it>and bin mapping in <it>Prunus </it>and <it>Fragaria</it>
					</p>
				</st>
				<p>The T&#215;E map of Dirlewanger et al. <abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp>, constructed with MapMaker/EXP v. 3.0 <abbrgrp>
						<abbr bid="B51">51</abbr>
					</abbrgrp>, was used as a standard for map comparisons. Data for the FV&#215;FN map, originally constructed with Joinmap 3.0 <abbrgrp>
						<abbr bid="B52">52</abbr>
					</abbrgrp> by Sargent et al. <abbrgrp>
						<abbr bid="B18">18</abbr>
					</abbrgrp>, was used for the mapping of novel loci in <it>Fragaria</it>. However, in order to make both maps comparable, the same data of the FV&#215;FN map plus those obtained here were used, but the map was reconstructed with MapMaker. The Kosambi mapping function was used to convert recombination units into genetic distances. The mapping procedure followed the guidelines of previous maps constructed in <it>Prunus </it>
					<abbrgrp>
						<abbr bid="B29">29</abbr>
					</abbrgrp>. The usual notation for the eight linkage groups of <it>Prunus </it>is G1 to G8 and for the seven <it>Fragaria </it>groups is I-VII. In order to facilitate the map comparison we have used on this occasion the terminology PG1&#8211;PG8 for <it>Prunus </it>and FG1&#8211;FG7 for <it>Fragaria</it>.</p>
				<p>A subset of six plants of the T&#215;E mapping population having a high number of recombination breakpoints and a uniform distribution across the <it>Prunus </it>genome was selected by Howad et al. <abbrgrp>
						<abbr bid="B15">15</abbr>
					</abbrgrp>. The genotype of this set of plants (the bin set) identified 64 fragments (bins) of the <it>Prunus </it>map with average size 7.8 cM. Following a similar approach, a bin set of six plants was selected from the FV&#215;FN mapping population by Sargent et al. <abbrgrp>
						<abbr bid="B22">22</abbr>
					</abbrgrp>. The <it>Fragaria </it>bin set detected 46 fragments of its genome with an average length of 12.6 cM. Using the bin sets of both species allowed us to establish the position of some of the markers with lower cost and effort than mapping with the whole population.</p>
			</sec>
			<sec>
				<st>
					<p>Mapping strategy</p>
				</st>
				<p>Table <tblr tid="T3">3</tblr> summarizes the mapping strategy employed for all novel markers mapped in this investigation. All RFLPs used were already mapped in <it>Prunus </it>using the entire T&#215;E progeny and were mapped in <it>Fragaria </it>using the entire FV&#215;FN population. The <it>Fragaria </it>and <it>Prunus </it>ESTs found to be polymorphic in the parents of the <it>Fragaria </it>mapping population were either sequenced in the <it>Fragaria </it>bin set and bin-mapped, or mapped in the whole FV&#215;FN population when clear intron length polymorphisms were detected. The eight <it>Fragaria </it>ESTs, previously mapped in FV&#215;FN, were bin mapped in <it>Prunus</it>. The SSRs were mapped in <it>Prunus </it>and <it>Fragaria </it>using all individuals of these populations. The data for each marker were scored independently by two researchers. Conflicting results were re-examined and in case of disagreement, the most conservative option was taken.</p>
			</sec>
			<sec>
				<st>
					<p>Estimating the number of chromosomal rearrangements</p>
				</st>
				<p>To estimate the number of chromosomal rearrangements that have occurred between <it>Prunus </it>and <it>Fragaria </it>since they diverged from a common ancestor, we elaborated a list of the markers of each of the <it>Fragaria </it>linkage groups with their correlative position on the <it>Prunus </it>linkage map. Taking FG1 as an example, this linkage group has seven anchor markers with order 7.2 (PG7, position 2), 7.3, 7.5, 7.4, 6.10, 6.6, 6.7. Then, we deduced the minimal number of mutations that would place the positions of these markers in the same order as in <it>Prunus</it>. In the example of FG1, we counted one translocation (between PG7 and PG6) and two inversions, one involving the 7.4&#8211;7.5 fragment and the other the 6.6&#8211;6.7 fragment, to give the final marker order: 7.2, 7.3, 7.4, 7.5, 6.10, 6.7, and 6.6. An additional mutation (probably caused by a translocation) had to occur to explain the gap between 6.10 and 6.7. This mutation was considered when analyzing the chromosome that received the translocated fragment. We counted one breakpoint per translocation and one per inversion. This is a lower boundary, as inversions may require one breakpoint if they involve the distal part of a chromosome, or two if they correspond to an internal fragment of a chromosome. Finally, we considered as translocations only those regions comprising two or more markers, as single-locus translocations are more likely to be spurious.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Authors' contributions</p>
			</st>
			<p>AM and PA conceived and designed the experiments. SV carried out the experiments with RFLPs in the <it>Fragaria </it>mapping population, DJS performed experimental work for mapping gene-specific markers in the <it>Fragaria </it>and <it>Prunus </it>bin mapping populations, and AM carried out the experimental work for mapping EST in the <it>Fragaria </it>population. PA coordinated the preparation of the manuscript to which all authors contributed, and read and approved the final manuscript.</p>
		</sec>
	</bdy>
   <bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>This research was supported in part with funds of the Spanish Ministry of Education project INIA (RTA2007-00063-00-00). Rosaceous genomics at East Malling is sponsored by Defra.</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>High density molecular linkage maps of the tomato and potato genomes</p>
				</title>
				<aug>
					<au>
						<snm>Tanksley</snm>
						<fnm>SD</fnm>
					</au>
					<au>
						<snm>Ganal</snm>
						<fnm>MW</fnm>
					</au>
					<au>
						<snm>Prince</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>De Vicente</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Bonierbale</snm>
						<fnm>MW</fnm>
					</au>
					<etal/>
				</aug>
				<source>Genetics</source>
				<pubdate>1992</pubdate>
				<volume>132</volume>
				<fpage>1141</fpage>
				<lpage>1160</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1205235</pubid>
						<pubid idtype="pmpid" link="fulltext">1360934</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>A comparative genetic linkage map of eggplant (<it>Solanum melongena</it>) and its implications for genome evolution in the Solanaceae</p>
				</title>
				<aug>
					<au>
						<snm>Doganlar</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Frary</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Daunay</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Lester</snm>
						<fnm>RN</fnm>
					</au>
					<au>
						<snm>Tanksley</snm>
						<fnm>SD</fnm>
					</au>
				</aug>
				<source>Genetics</source>
				<pubdate>2002</pubdate>
				<volume>161</volume>
				<fpage>1697</fpage>
				<lpage>1711</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1462225</pubid>
						<pubid idtype="pmpid" link="fulltext">12196412</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Genome relationships: the grass model in current research</p>
				</title>
				<aug>
					<au>
						<snm>Devos</snm>
						<fnm>KM</fnm>
					</au>
					<au>
						<snm>Gale</snm>
						<fnm>MD</fnm>
					</au>
				</aug>
				<source>Plant Cell</source>
				<pubdate>2000</pubdate>
				<volume>12</volume>
				<fpage>637</fpage>
				<lpage>646</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">139917</pubid>
						<pubid idtype="pmpid" link="fulltext">10810140</pubid>
						<pubid idtype="doi">10.1105/tpc.12.5.637</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B4">
				<title>
					<p>Estimating genome conservation between crop and model legume species</p>
				</title>
				<aug>
					<au>
						<snm>Choi</snm>
						<fnm>HK</fnm>
					</au>
					<au>
						<snm>Mun</snm>
						<fnm>JH</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Zhu</snm>
						<fnm>HY</fnm>
					</au>
					<au>
						<snm>Baek</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Mudge</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Roe</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Ellis</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Doyle</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Kiss</snm>
						<fnm>GB</fnm>
					</au>
					<au>
						<snm>Young</snm>
						<fnm>ND</fnm>
					</au>
					<au>
						<snm>Cook</snm>
						<fnm>DR</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>2004</pubdate>
				<volume>101</volume>
				<fpage>15289</fpage>
				<lpage>15294</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">524433</pubid>
						<pubid idtype="pmpid" link="fulltext">15489274</pubid>
						<pubid idtype="doi">10.1073/pnas.0402251101</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>Comparative genomics in the Brassicaceae: a family-wide perspective</p>
				</title>
				<aug>
					<au>
						<snm>Schranz</snm>
						<fnm>ME</fnm>
					</au>
					<au>
						<snm>Song</snm>
						<fnm>BH</fnm>
					</au>
					<au>
						<snm>Windsor</snm>
						<fnm>AJ</fnm>
					</au>
					<au>
						<snm>Mitchell-Olds</snm>
						<fnm>T</fnm>
					</au>
				</aug>
				<source>Curr Opin Plant Biol</source>
				<pubdate>2007</pubdate>
				<volume>10</volume>
				<fpage>168</fpage>
				<lpage>175</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.pbi.2007.01.014</pubid>
						<pubid idtype="pmpid" link="fulltext">17300984</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Toward a unfied genetic map of higher plants, transcending the monocot-dicot divergence</p>
				</title>
				<aug>
					<au>
						<snm>Paterson</snm>
						<fnm>AH</fnm>
					</au>
					<au>
						<snm>Lan</snm>
						<fnm>TH</fnm>
					</au>
					<au>
						<snm>Reischmann</snm>
						<fnm>KP</fnm>
					</au>
					<au>
						<snm>Chang</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Lin</snm>
						<fnm>YR</fnm>
					</au>
					<etal/>
				</aug>
				<source>Nature Genet</source>
				<pubdate>1996</pubdate>
				<volume>14</volume>
				<fpage>380</fpage>
				<lpage>386</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/ng1296-380</pubid>
						<pubid idtype="pmpid" link="fulltext">8944014</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<title>
					<p>Synteny between <it>Arabidopsis thaliana </it>and rice at the genome level: a tool to identify conservation in the ongoing rice genome sequencing project</p>
				</title>
				<aug>
					<au>
						<snm>Salse</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Pi&#233;gu</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Cooke</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Delseny</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Nucleic Acids Res</source>
				<pubdate>2002</pubdate>
				<volume>30</volume>
				<fpage>2316</fpage>
				<lpage>2328</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">117207</pubid>
						<pubid idtype="pmpid" link="fulltext">12034818</pubid>
						<pubid idtype="doi">10.1093/nar/30.11.2316</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B8">
				<title>
					<p>Plant genome archaeology: evidence for conserved ancestral chromosome segments in dicotyledonous plant species</p>
				</title>
				<aug>
					<au>
						<snm>Dominguez</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Graziano</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Gebhardt</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Barakat</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Berry</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Ar&#250;s</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Delseny</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Barnes</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>Plant Biotech J</source>
				<pubdate>2003</pubdate>
				<volume>1</volume>
				<fpage>91</fpage>
				<lpage>99</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1046/j.1467-7652.2003.00009.x</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>Comparative genomics of <it>Gossypium </it>and <it>Arabidopsis</it>: Unraveling the consequences of both ancient and recent polyploidy</p>
				</title>
				<aug>
					<au>
						<snm>Rong</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bowers</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Schulze</snm>
						<fnm>SR</fnm>
					</au>
					<au>
						<snm>Waghmare</snm>
						<fnm>VN</fnm>
					</au>
					<au>
						<snm>Rogers</snm>
						<fnm>CJ</fnm>
					</au>
					<etal/>
				</aug>
				<source>Genome Res</source>
				<pubdate>2005</pubdate>
				<volume>15</volume>
				<fpage>1198</fpage>
				<lpage>1210</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1199534</pubid>
						<pubid idtype="pmpid" link="fulltext">16109973</pubid>
						<pubid idtype="doi">10.1101/gr.3907305</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B10">
				<aug>
					<au>
						<snm>Judd</snm>
						<fnm>WS</fnm>
					</au>
					<au>
						<snm>Campbell</snm>
						<fnm>CS</fnm>
					</au>
					<au>
						<snm>Kellogg</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Stevens</snm>
						<fnm>PF</fnm>
					</au>
				</aug>
				<source>Plant systematics, a phylogenetic approach</source>
				<publisher>Sunderland M.A. Sinauer Associates</publisher>
				<pubdate>1999</pubdate>
			</bibl>
			<bibl id="B11">
				<title>
					<p>Estimation of the nuclear DNA content of strawberries (<it>Fragaria </it>spp.) compared with Arabidopsis thaliana by using dual system flow cytometry</p>
				</title>
				<aug>
					<au>
						<snm>Akiyama</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Yamamoto</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Ohmido</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Oshima</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Fukui</snm>
						<fnm>K</fnm>
					</au>
				</aug>
				<source>Cytologia</source>
				<pubdate>2001</pubdate>
				<volume>66</volume>
				<fpage>431</fpage>
				<lpage>436</lpage>
			</bibl>
			<bibl id="B12">
				<title>
					<p>Nuclear DNA content of some important plant species</p>
				</title>
				<aug>
					<au>
						<snm>Arumuganathan</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Earle</snm>
						<fnm>ED</fnm>
					</au>
				</aug>
				<source>Plant Mol Biol Rep</source>
				<pubdate>1991</pubdate>
				<volume>9</volume>
				<fpage>208</fpage>
				<lpage>218</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1007/BF02672069</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>Synteny in the Rosaceae</p>
				</title>
				<aug>
					<au>
						<snm>Ar&#250;s</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Yamamoto</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Dirlewanger</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Abbott</snm>
						<fnm>AG</fnm>
					</au>
				</aug>
				<source>Plant Breeding Reviews</source>
				<publisher>London, John Wiley and Sons Inc</publisher>
				<editor>Janick J</editor>
				<pubdate>2005</pubdate>
				<fpage>175</fpage>
				<lpage>211</lpage>
			</bibl>
			<bibl id="B14">
				<title>
					<p>Comparative mapping and marker-assisted selection in Rosaceae fruit crops</p>
				</title>
				<aug>
					<au>
						<snm>Dirlewanger</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Graziano</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Joobeur</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Garriga-Caldere</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Cosson</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Howad</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Arus</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Proc Nat Acad Sci USA</source>
				<pubdate>2004</pubdate>
				<volume>101</volume>
				<fpage>9891</fpage>
				<lpage>9896</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">470769</pubid>
						<pubid idtype="pmpid" link="fulltext">15159547</pubid>
						<pubid idtype="doi">10.1073/pnas.0307937101</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>Mapping with a few plants: using selective mapping for microsatellite saturation of the <it>Prunus </it>reference map</p>
				</title>
				<aug>
					<au>
						<snm>Howad</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Yamamoto</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Dirlewanger</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Testolin</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Cosson</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Cipriani</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Monforte</snm>
						<fnm>AJ</fnm>
					</au>
					<au>
						<snm>Georgi</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Abbott</snm>
						<fnm>AG</fnm>
					</au>
					<au>
						<snm>Arus</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Genetics</source>
				<pubdate>2005</pubdate>
				<volume>171</volume>
				<fpage>1305</fpage>
				<lpage>1309</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1456826</pubid>
						<pubid idtype="pmpid" link="fulltext">16118196</pubid>
						<pubid idtype="doi">10.1534/genetics.105.043661</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B16">
				<title>
					<p>Genetic linkage maps of Japanese and European pears aligned to the apple consensus map</p>
				</title>
				<aug>
					<au>
						<snm>Yamamoto</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Kimura</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Saito</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Kotobuki</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Matsuta</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Liebhard</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Gessler</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Weg</snm>
						<mnm>van de</mnm>
						<fnm>WE</fnm>
					</au>
					<au>
						<snm>Hayashi</snm>
						<fnm>T</fnm>
					</au>
				</aug>
				<source>Acta Hort</source>
				<pubdate>2004</pubdate>
				<volume>663</volume>
				<fpage>51</fpage>
				<lpage>56</lpage>
			</bibl>
			<bibl id="B17">
				<title>
					<p>Characterisation and transferability of apple SSRs to two European pear F<sub>1 </sub>populations</p>
				</title>
				<aug>
					<au>
						<snm>Pierantoni</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Cho</snm>
						<fnm>KH</fnm>
					</au>
					<au>
						<snm>Shin</snm>
						<fnm>IS</fnm>
					</au>
					<au>
						<snm>Chidoni</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Tartarini</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Dondini</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Kang</snm>
						<fnm>SJ</fnm>
					</au>
					<au>
						<snm>Sansavini</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>2004</pubdate>
				<volume>109</volume>
				<fpage>1519</fpage>
				<lpage>1524</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00122-004-1775-9</pubid>
						<pubid idtype="pmpid" link="fulltext">15340685</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>An enhanced microsatellite map of diploid <it>Fragaria</it>
					</p>
				</title>
				<aug>
					<au>
						<snm>Sargent</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Clarke</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Simpson</snm>
						<fnm>DW</fnm>
					</au>
					<au>
						<snm>Tobutt</snm>
						<fnm>KR</fnm>
					</au>
					<au>
						<snm>Arus</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Monfort</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Vilanova</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Denoyes-Rothan</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Rousseau</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Folta</snm>
						<fnm>KM</fnm>
					</au>
					<au>
						<snm>Bassil</snm>
						<fnm>NV</fnm>
					</au>
					<au>
						<snm>Battey</snm>
						<fnm>NH</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>2006</pubdate>
				<volume>112</volume>
				<fpage>1349</fpage>
				<lpage>1359</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00122-006-0237-y</pubid>
						<pubid idtype="pmpid" link="fulltext">16505996</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>GDR (Genome Database for Rosaceae): integrated web resources for Rosaceae genomics and genetics research</p>
				</title>
				<aug>
					<au>
						<snm>Jung</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Jesudurai</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Staton</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Du</snm>
						<fnm>ZD</fnm>
					</au>
					<au>
						<snm>Ficklin</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Cho</snm>
						<fnm>IH</fnm>
					</au>
					<au>
						<snm>Abbott</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Tomkins</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Main</snm>
						<fnm>D</fnm>
					</au>
				</aug>
				<source>BMC Bioinformatics</source>
				<pubdate>2004</pubdate>
				<volume>5</volume>
				<fpage>130</fpage>
				<url>http://www.bioinfo.wsu.edu/gdr/</url>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">517928</pubid>
						<pubid idtype="pmpid" link="fulltext">15357877</pubid>
						<pubid idtype="doi">10.1186/1471-2105-5-130</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>Phylogeny and classification of Rosaceae</p>
				</title>
				<aug>
					<au>
						<snm>Potter</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Eriksson</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Evans</snm>
						<fnm>RC</fnm>
					</au>
					<au>
						<snm>Oh</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Smedmark</snm>
						<fnm>JEE</fnm>
					</au>
					<au>
						<snm>Morgan</snm>
						<fnm>DR</fnm>
					</au>
					<au>
						<snm>Kerr</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Robertson</snm>
						<fnm>KR</fnm>
					</au>
					<au>
						<snm>Arsenault</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Dickinson</snm>
						<fnm>TA</fnm>
					</au>
					<au>
						<snm>Campbell</snm>
						<fnm>CS</fnm>
					</au>
				</aug>
				<source>Plant Syst Evol</source>
				<pubdate>2007</pubdate>
				<volume>266</volume>
				<fpage>5</fpage>
				<lpage>43</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1007/s00606-007-0539-9</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B21">
				<title>
					<p>The development and mapping of functional markers in <it>Fragaria </it>and their transferability and potentialfor mapping in other genera</p>
				</title>
				<aug>
					<au>
						<snm>Sargent</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Rijs</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Nier</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Simpson</snm>
						<fnm>DW</fnm>
					</au>
					<au>
						<snm>Tobutt</snm>
						<fnm>KR</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>2007</pubdate>
				<volume>114</volume>
				<fpage>373</fpage>
				<lpage>384</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00122-006-0441-9</pubid>
						<pubid idtype="pmpid" link="fulltext">17091261</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B22">
				<title>
					<p>The development of a bin mapping population and the selective mapping of 103 markers in the diploid <it>Fragaria </it>reference mapping population FV&#215;FN</p>
				</title>
				<aug>
					<au>
						<snm>Sargent</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Cipriani</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Vilanova</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Gil-Ariza</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Ar&#250;s</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Simpson</snm>
						<fnm>DW</fnm>
					</au>
					<au>
						<snm>Tobutt</snm>
						<fnm>KR</fnm>
					</au>
					<au>
						<snm>Monfort</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Genome</source>
				<pubdate>2008</pubdate>
				<volume>51</volume>
				<fpage>120</fpage>
				<lpage>127</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1139/G07-107</pubid>
						<pubid idtype="pmpid" link="fulltext">18356946</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B23">
				<title>
					<p>Systematic and evolutionary implications of the <it>RBC </it>L sequence variation in Rosaceae</p>
				</title>
				<aug>
					<au>
						<snm>Morgan</snm>
						<fnm>DR</fnm>
					</au>
					<au>
						<snm>Soltis</snm>
						<fnm>DE</fnm>
					</au>
					<au>
						<snm>Robertson</snm>
						<fnm>KR</fnm>
					</au>
				</aug>
				<source>Amer J Bot</source>
				<pubdate>1994</pubdate>
				<volume>81</volume>
				<fpage>890</fpage>
				<lpage>903</lpage>
				<xrefbib>
					<pubid idtype="doi">10.2307/2445770</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B24">
				<title>
					<p>Tentative d'utilisation des protoplastes pour l'etude des chromosomes chez les <it>Prunus</it>
					</p>
				</title>
				<aug>
					<au>
						<snm>Salesses</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Mouras</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Ann Amelior Plantes</source>
				<pubdate>1977</pubdate>
				<volume>27</volume>
				<fpage>363</fpage>
				<lpage>368</lpage>
			</bibl>
			<bibl id="B25">
				<title>
					<p>Karyotype analysis of an haploid plant of apple (<it>Malus domestica</it>)</p>
				</title>
				<aug>
					<au>
						<snm>Bouvier</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Lespinasse</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Schuster</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Acta Horticulturae</source>
				<pubdate>2000</pubdate>
				<volume>538</volume>
				<fpage>321</fpage>
				<lpage>324</lpage>
			</bibl>
			<bibl id="B26">
				<title>
					<p>Karyotypes of three species of <it>Fragaria </it>(Rosaceae)</p>
				</title>
				<aug>
					<au>
						<snm>Iwatsubo</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Naruhashi</snm>
						<fnm>N</fnm>
					</au>
				</aug>
				<source>Cytologia</source>
				<pubdate>1989</pubdate>
				<volume>54</volume>
				<fpage>493</fpage>
				<lpage>497</lpage>
			</bibl>
			<bibl id="B27">
				<title>
					<p>Conservation of gene repertoire but not gene order in pepper and tomato</p>
				</title>
				<aug>
					<au>
						<snm>Tanksley</snm>
						<fnm>SD</fnm>
					</au>
					<au>
						<snm>Bernatzky</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Lapitan</snm>
						<fnm>NL</fnm>
					</au>
					<au>
						<snm>Prince</snm>
						<fnm>JP</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1988</pubdate>
				<volume>85</volume>
				<fpage>6419</fpage>
				<lpage>6423</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">281983</pubid>
						<pubid idtype="pmpid" link="fulltext">16593975</pubid>
						<pubid idtype="doi">10.1073/pnas.85.17.6419</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B28">
				<title>
					<p>A linkage map with RFLP and isozyme markers for almond</p>
				</title>
				<aug>
					<au>
						<snm>Viruel</snm>
						<fnm>MA</fnm>
					</au>
					<au>
						<snm>Messeguer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>de Vicente</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Garcia-Mas</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Puigdomenech</snm>
						<fnm>P</fnm>
					</au>
					<etal/>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>1995</pubdate>
				<volume>91</volume>
				<fpage>964</fpage>
				<lpage>971</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1007/BF00223907</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B29">
				<title>
					<p>Construction of a saturated linkage map for <it>Prunus </it>using an almond &#215; peach F2 progeny</p>
				</title>
				<aug>
					<au>
						<snm>Joobeur</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Viruel</snm>
						<fnm>MA</fnm>
					</au>
					<au>
						<snm>de Vicente</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Jauregui</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Ballester</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Dettori</snm>
						<fnm>MT</fnm>
					</au>
					<au>
						<snm>Verde</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Truco</snm>
						<fnm>MJ</fnm>
					</au>
					<au>
						<snm>Messeguer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Batlle</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Quarta</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Dirlewanger</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Arus</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>1998</pubdate>
				<volume>97</volume>
				<fpage>1034</fpage>
				<lpage>1041</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1007/s001220050988</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B30">
				<title>
					<p>Genome mapping in <it>Capsicum </it>and the evolution of genome structure in the Solanaceae</p>
				</title>
				<aug>
					<au>
						<snm>Livingstone</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Lackney</snm>
						<fnm>VK</fnm>
					</au>
					<au>
						<snm>Blauth</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Wijk</snm>
						<fnm>RV</fnm>
					</au>
					<au>
						<snm>Jahn</snm>
						<fnm>MK</fnm>
					</au>
				</aug>
				<source>Genetics</source>
				<pubdate>1999</pubdate>
				<volume>152</volume>
				<fpage>1183</fpage>
				<lpage>1202</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1460652</pubid>
						<pubid idtype="pmpid" link="fulltext">10388833</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B31">
				<title>
					<p>RFLP maps based on a common set of clones reveal modes of chromosomal evolution in potato an tomato</p>
				</title>
				<aug>
					<au>
						<snm>Bonierbale</snm>
						<fnm>MW</fnm>
					</au>
					<au>
						<snm>Plaisted</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Tanksley</snm>
						<fnm>SD</fnm>
					</au>
				</aug>
				<source>Genetics</source>
				<pubdate>1988</pubdate>
				<volume>120</volume>
				<fpage>1095</fpage>
				<lpage>1103</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1203572</pubid>
						<pubid idtype="pmpid" link="fulltext">17246486</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B32">
				<title>
					<p>Comparative mapping between <it>Arabidopsis thaliana </it>and <it>Brassica nigra </it>Indicates that <it>Brassica </it>genomes have evolved through extensive genome replication accompanied by chromosome fusions and frequent rearrangements</p>
				</title>
				<aug>
					<au>
						<snm>Lagercrantz</snm>
						<fnm>U</fnm>
					</au>
				</aug>
				<source>Genetics</source>
				<pubdate>1998</pubdate>
				<volume>150</volume>
				<fpage>1217</fpage>
				<lpage>1228</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1460378</pubid>
						<pubid idtype="pmpid" link="fulltext">9799273</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B33">
				<title>
					<p>Comparative genome analyses of <it>Arabidopsis </it>spp.: Inferring chromosomal rearrangement events in the evolutionary history of <it>A. thaliana</it>
					</p>
				</title>
				<aug>
					<au>
						<snm>Yogeeswaran</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Frary</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>York</snm>
						<fnm>TL</fnm>
					</au>
					<au>
						<snm>Amenta</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Lesser</snm>
						<fnm>AH</fnm>
					</au>
					<au>
						<snm>Nasrallah</snm>
						<fnm>JB</fnm>
					</au>
					<au>
						<snm>Tanksley</snm>
						<fnm>SD</fnm>
					</au>
					<au>
						<snm>Nasrallah</snm>
						<fnm>ME</fnm>
					</au>
				</aug>
				<source>Genome Res</source>
				<pubdate>2006</pubdate>
				<volume>15</volume>
				<fpage>505</fpage>
				<lpage>515</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1101/gr.3436305</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B34">
				<title>
					<p>Comparative genomics of plant chromosomes</p>
				</title>
				<aug>
					<au>
						<snm>Paterson</snm>
						<fnm>AH</fnm>
					</au>
					<au>
						<snm>Bowers</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Burow</snm>
						<fnm>MD</fnm>
					</au>
					<au>
						<snm>Draye</snm>
						<fnm>X</fnm>
					</au>
					<au>
						<snm>Elsik</snm>
						<fnm>CG</fnm>
					</au>
					<au>
						<snm>Jiang</snm>
						<fnm>CX</fnm>
					</au>
					<au>
						<snm>Katsar</snm>
						<fnm>CS</fnm>
					</au>
					<au>
						<snm>Lan</snm>
						<fnm>TH</fnm>
					</au>
					<au>
						<snm>Lin</snm>
						<fnm>YR</fnm>
					</au>
					<au>
						<snm>Ming</snm>
						<fnm>RG</fnm>
					</au>
					<au>
						<snm>Wright</snm>
						<fnm>RJ</fnm>
					</au>
				</aug>
				<source>Plant Cell</source>
				<pubdate>2000</pubdate>
				<volume>12</volume>
				<fpage>1523</fpage>
				<lpage>1539</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">149067</pubid>
						<pubid idtype="pmpid" link="fulltext">11006329</pubid>
						<pubid idtype="doi">10.1105/tpc.12.9.1523</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B35">
				<title>
					<p>Centromeric sites and cereal chromosome evolution</p>
				</title>
				<aug>
					<au>
						<snm>Moore</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Roberts</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Aragon-Alcaide</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Foote</snm>
						<fnm>T</fnm>
					</au>
				</aug>
				<source>Chromosoma</source>
				<pubdate>1997</pubdate>
				<volume>105</volume>
				<fpage>321</fpage>
				<lpage>323</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">9087373</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B36">
				<title>
					<p>Chromosome evolution</p>
				</title>
				<aug>
					<au>
						<snm>Schubert</snm>
						<fnm>I</fnm>
					</au>
				</aug>
				<source>Curr Opin Plant Biol</source>
				<pubdate>2007</pubdate>
				<volume>10</volume>
				<fpage>109</fpage>
				<lpage>115</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.pbi.2007.01.001</pubid>
						<pubid idtype="pmpid" link="fulltext">17289425</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B37">
				<title>
					<p>A reciprocal translocation between 'Garfi' almond and 'Nemared' peach</p>
				</title>
				<aug>
					<au>
						<snm>J&#225;uregui</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>de Vicente</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Messeguer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Felipe</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Bonnet</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Salesses</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Arus</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>2001</pubdate>
				<volume>102</volume>
				<fpage>1169</fpage>
				<lpage>1176</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1007/s001220000511</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B38">
				<title>
					<p>A deletion affecting several gene candidates in present in the evergrowing peach mutant</p>
				</title>
				<aug>
					<au>
						<snm>Bielenberg</snm>
						<fnm>DG</fnm>
					</au>
					<au>
						<snm>Wang</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Fan</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Reighard</snm>
						<fnm>GL</fnm>
					</au>
					<au>
						<snm>Scorza</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Abbott</snm>
						<fnm>AG</fnm>
					</au>
				</aug>
				<source>J Hered</source>
				<pubdate>2004</pubdate>
				<volume>95</volume>
				<fpage>436</fpage>
				<lpage>444</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1093/jhered/esh057</pubid>
						<pubid idtype="pmpid" link="fulltext">15388771</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B39">
				<title>
					<p>Looking into flowering time in almond (<it>Prunus dulcis </it>(Mill) D.A. Webb): the candidate gene approach</p>
				</title>
				<aug>
					<au>
						<snm>Silva</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Garcia-Mas</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Sanchez</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Ar&#250;s</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Oliveira</snm>
						<fnm>MM</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>2005</pubdate>
				<volume>110</volume>
				<fpage>959</fpage>
				<lpage>968</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00122-004-1918-z</pubid>
						<pubid idtype="pmpid" link="fulltext">15700145</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B40">
				<title>
					<p>Peach Mendelian genetics: a short review and new results</p>
				</title>
				<aug>
					<au>
						<snm>Monet</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Guye</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Roy</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Dachary</snm>
						<fnm>N</fnm>
					</au>
				</aug>
				<source>Agronomie</source>
				<pubdate>1996</pubdate>
				<volume>16</volume>
				<fpage>321</fpage>
				<lpage>329</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1051/agro:19960505</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B41">
				<title>
					<p>Strawberry genes and genomics</p>
				</title>
				<aug>
					<au>
						<snm>Folta</snm>
						<fnm>KM</fnm>
					</au>
					<au>
						<snm>Davis</snm>
						<fnm>TM</fnm>
					</au>
				</aug>
				<source>Critical Rev Plant Sci</source>
				<pubdate>2006</pubdate>
				<volume>25</volume>
				<fpage>399</fpage>
				<lpage>415</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1080/07352680600824831</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B42">
				<title>
					<p>A rapid DNA isolation procedure for small quantities of fresh leaf tissue</p>
				</title>
				<aug>
					<au>
						<snm>Doyle</snm>
						<fnm>JJ</fnm>
					</au>
					<au>
						<snm>Doyle</snm>
						<fnm>JL</fnm>
					</au>
				</aug>
				<source>Phytochem Bull</source>
				<pubdate>1987</pubdate>
				<volume>19</volume>
				<fpage>11</fpage>
				<lpage>15</lpage>
			</bibl>
			<bibl id="B43">
				<title>
					<p>Candidate gene database and transcript map for peach, a model species for fruit trees</p>
				</title>
				<aug>
					<au>
						<snm>Horn</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Lecouls</snm>
						<fnm>AC</fnm>
					</au>
					<au>
						<snm>Callahan</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Dandekar</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Garay</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>McCord</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Howad</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Chan</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Verde</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Main</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Jung</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Georgi</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Forrest</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Mook</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Zhebentyayeva</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Yu</snm>
						<fnm>YS</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>HR</fnm>
					</au>
					<au>
						<snm>Jesudurai</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Sosinski</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Arus</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Baird</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Parfitt</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Reighard</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Scorza</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Tomkins</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Wing</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Abbott</snm>
						<fnm>AG</fnm>
					</au>
				</aug>
				<source>Theor Appl Genet</source>
				<pubdate>2005</pubdate>
				<volume>110</volume>
				<fpage>1419</fpage>
				<lpage>1428</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00122-005-1968-x</pubid>
						<pubid idtype="pmpid" link="fulltext">15846479</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B44">
				<title>
					<p>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs</p>
				</title>
				<aug>
					<au>
						<snm>Atschul</snm>
						<fnm>SF</fnm>
					</au>
					<au>
						<snm>Madden</snm>
						<fnm>TL</fnm>
					</au>
					<au>
						<snm>Schaffer</snm>
						<fnm>AA</fnm>
					</au>
					<au>
						<snm>Zhang</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Zhang</snm>
						<fnm>Z</fnm>
					</au>
					<au>
						<snm>Miller</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Lipman</snm>
						<fnm>DJ</fnm>
					</au>
				</aug>
				<source>Nucleic Acids Res</source>
				<pubdate>1997</pubdate>
				<volume>25</volume>
				<fpage>3389</fpage>
				<lpage>3402</lpage>
				<url>http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi</url>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">146917</pubid>
						<pubid idtype="pmpid" link="fulltext">9254694</pubid>
						<pubid idtype="doi">10.1093/nar/25.17.3389</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B45">
				<title>
					<p>Arabidopsis genome sequence</p>
				</title>
				<url>http://arabidopsis.org</url>
			</bibl>
			<bibl id="B46">
				<title>
					<p>Primer3</p>
				</title>
				<url>http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi</url>
			</bibl>
			<bibl id="B47">
				<title>
					<p>Development and characterisation of polymorphic microsatellite markers from <it>Fragaria viridis</it>, a wild diploid strawberry</p>
				</title>
				<aug>
					<au>
						<snm>Sargent</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Hadonou</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Simpson</snm>
						<fnm>DW</fnm>
					</au>
				</aug>
				<source>Mol Ecol Notes</source>
				<pubdate>2003</pubdate>
				<volume>3</volume>
				<fpage>550</fpage>
				<lpage>552</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1046/j.1471-8286.2003.00507.x</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B48">
				<title>
					<p>The Staden sequence analysis package</p>
				</title>
				<aug>
					<au>
						<snm>Staden</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>Mol Biotechnol</source>
				<pubdate>1996</pubdate>
				<volume>5</volume>
				<fpage>233</fpage>
				<lpage>241</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/BF02900361</pubid>
						<pubid idtype="pmpid">8837029</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B49">
				<title>
					<p>Genomic and cDNA microsatellites from apricot (<it>Prunus armeniaca </it>L.)</p>
				</title>
				<aug>
					<au>
						<snm>Hagen</snm>
						<fnm>LS</fnm>
					</au>
					<au>
						<snm>Chaib</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Fady</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Decroocq</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Bouchet</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Lambert</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Audergon</snm>
						<fnm>JM</fnm>
					</au>
				</aug>
				<source>Mol Ecol Notes</source>
				<pubdate>2004</pubdate>
				<volume>4</volume>
				<fpage>742</fpage>
				<lpage>745</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1111/j.1471-8286.2004.00802.x</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B50">
				<title>
					<p>A new set of polymorphic simple sequence repeat (SSR) markers from a wild strawberry (<it>Fragaria vesca</it>) are transferable to other diploid <it>Fragaria </it>species and to <it>Fragaria x ananassa</it>
					</p>
				</title>
				<aug>
					<au>
						<snm>Monfort</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Vilanova</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Davis</snm>
						<fnm>TM</fnm>
					</au>
					<au>
						<snm>Ar&#250;s</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Mol Ecol Notes</source>
				<pubdate>2006</pubdate>
				<volume>6</volume>
				<fpage>197</fpage>
				<lpage>200</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1111/j.1471-8286.2005.01191.x</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B51">
				<title>
					<p>MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations</p>
				</title>
				<aug>
					<au>
						<snm>Lander</snm>
						<fnm>ES</fnm>
					</au>
					<au>
						<snm>Gree</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Abrahansom</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Barlow</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Daly</snm>
						<fnm>MJ</fnm>
					</au>
					<etal/>
				</aug>
				<source>Genomics</source>
				<pubdate>1987</pubdate>
				<volume>1</volume>
				<fpage>174</fpage>
				<lpage>181</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0888-7543(87)90010-3</pubid>
						<pubid idtype="pmpid" link="fulltext">3692487</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B52">
				<title>
					<p>Joinmap 3.0:software for the calculation of genetic linkage maps</p>
				</title>
				<aug>
					<au>
						<snm>Van Ooijen</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Voorrips</snm>
						<fnm>RE</fnm>
					</au>
				</aug>
				<publisher>Plant research International, Wageningen, The Nederlands</publisher>
				<pubdate>2001</pubdate>
			</bibl>
		</refgrp>
	</bm>
</art>
