<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2229-8-51</ui>
   <ji>1471-2229</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Development of new genomic microsatellite markers from robusta coffee (<it>Coffea canephora </it>Pierre ex A. Froehner) showing broad cross-species transferability and utility in genetic studies</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Hendre</snm>
               <mnm>Suresh</mnm>
               <fnm>Prasad</fnm>
               <insr iid="I1"/>
               <email>prasadhendre@gmail.com</email>
            </au>
            <au id="A2">
               <snm>Phanindranath</snm>
               <fnm>Regur</fnm>
               <insr iid="I1"/>
               <email>phanindra@ccmb.res.in</email>
            </au>
            <au id="A3">
               <snm>Annapurna</snm>
               <fnm>V</fnm>
               <insr iid="I1"/>
               <email>purnavneni@yahoo.com</email>
            </au>
            <au id="A4">
               <snm>Lalremruata</snm>
               <fnm>Albert</fnm>
               <insr iid="I1"/>
               <email>albert.ccmb@gmail.com</email>
            </au>
            <au id="A5" ca="yes">
               <snm>Aggarwal</snm>
               <mi>K</mi>
               <fnm>Ramesh</fnm>
               <insr iid="I1"/>
               <email>rameshka@ccmb.res.in</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Centre for Cellular and Molecular Biology (CCMB), Uppal Road, Tarnaka, Hyderabad- 500 007, Andhra Pradesh, India</p>
            </ins>
         </insg>
         <source>BMC Plant Biology</source>
         <issn>1471-2229</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>51</fpage>
         <url>http://www.biomedcentral.com/1471-2229/8/51</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18447947</pubid>
               <pubid idtype="doi">10.1186/1471-2229-8-51</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>27</day>
               <month>9</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>30</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>30</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Hendre et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Species-specific microsatellite markers are desirable for genetic studies and to harness the potential of MAS-based breeding for genetic improvement. Limited availability of such markers for coffee, one of the most important beverage tree crops, warrants newer efforts to develop additional microsatellite markers that can be effectively deployed in genetic analysis and coffee improvement programs. The present study aimed to develop new coffee-specific SSR markers and validate their utility in analysis of genetic diversity, individualization, linkage mapping, and transferability for use in other related taxa.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>A small-insert partial genomic library of <it>Coffea canephora</it>, was probed for various SSR motifs following conventional approach of Southern hybridisation. Characterization of repeat positive clones revealed a very high abundance of DNRs (1/15 Kb) over TNRs (1/406 kb). The relative frequencies of different DNRs were found as AT >> AG > AC, whereas among TNRs, AGC was the most abundant repeat. The SSR positive sequences were used to design 58 primer pairs of which 44 pairs could be validated as single locus markers using a panel of arabica and robusta genotypes. The analysis revealed an average of 3.3 and 3.78 alleles and 0.49 and 0.62 PIC per marker for the tested arabicas and robustas, respectively. It also revealed a high cumulative PI over all the markers using both sib-based (10<sup>-6 </sup>and 10<sup>-12 </sup>for arabicas and robustas respectively) and unbiased corrected estimates (10<sup>-20 </sup>and 10<sup>-43 </sup>for arabicas and robustas respectively). The markers were tested for Hardy-Weinberg equilibrium, linkage dis-equilibrium, and were successfully used to ascertain generic diversity/affinities in the tested germplasm (cultivated as well as species). Nine markers could be mapped on robusta linkage map. Importantly, the markers showed ~92% transferability across related species/genera of coffee.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The conventional approach of genomic library was successfully employed although with low efficiency to develop a set of 44 new genomic microsatellite markers of coffee. The characterization/validation of new markers demonstrated them to be highly informative, and useful for genetic studies namely, genetic diversity in coffee germplasm, individualization/bar-coding for germplasm protection, linkage mapping, taxonomic studies, and use as conserved orthologous sets across secondary genepool of coffee. Further, the relative frequency and distribution of different SSR motifs in coffee genome indicated coffee genome to be relatively poor in microsatellites compared to other plant species.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Coffee tree, a member of the family Rubiaceae, belongs to the genus <it>Coffea </it>that comprises > 100 species. Of these two species, the tetraploid <it>Coffea arabica </it>L. (i.e. arabica coffee; 2n = 4x = 44) and the diploid <it>C. canephora </it>Pierre ex A. Froehner (i.e. robusta coffee; 2n = 2x = 22), are cultivated commercially. Coffee, one of the most popular non-alcoholic beverages, is consumed regularly by 40% of the world population mostly in the developed world <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, and thus occupies a strategic position in the world socio-economy.</p>
         <p>Efforts undertaken globally to improve coffee, though successful, have proven to be too slow and severely constrained owing to various factors. The latter includes: genetic and physiological makeup (low genetic diversity and ploidy barrier in arabicas, and self incompatibility/easy cross-species fertilization in robustas), long generation cycle, requirement of huge land resources, and equally the dearth of easily accessible and assayable genetic tools/techniques for screening/selection. The situation warrants recourse to newer, easy, practical technologies that can provide acceleration, reliability and directionality to the breeding efforts, and allow characterization of cultivated/secondary genepool for proper utilization of the available germplasm in genetic improvement programs. In this context, development of DNA marker tools and availability of markers-based molecular linkage maps becomes imperative for MAS-based accelerated breeding of improved coffee genotypes.</p>
         <p>Among the different types of DNA markers, the Short Sequence Repeats (SSR) based microsatellite markers promise to be the most ideal ones due to their multi-allelic nature, high polymorphism content, locus specificity, reproducibility, inter-lab transferability and ease for automation <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Microsatellite markers have been developed for a large number of plant species and are increasingly being used for ascertaining germplasm diversity, linkage analysis and molecular breeding <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Despite these advantages, only ~180 microsatellite markers have been reported till to date for coffee <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>, signifying the need for expanding the repertoire of these genetically highly informative markers for efficient management and improvement of coffee germplasm resources. Here we report, a set of 44 novel microsatellite markers developed by radioactive screening of a small-insert partial genomic library of <it>C. canephora </it>(robusta coffee). Interestingly, all these markers exhibit broad cross-species transferability. We also demonstrate their utility as genetic markers for ascertaining the germplasm diversity, genotype individualization, linkage mapping and taxonomic affinities.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>The present study aimed to isolate new coffee-specific informative SSRs useful as genetic markers for characterizing coffee genome and linkage mapping studies. For the purpose, a partial small-insert genomic library was constructed from a commercially cultivated robusta variety 'Sln-274'. The library was screened using radioactive SSR oligo probes to isolate SSR-containing DNA fragments, which were sequenced and used for designing primer pairs from the flanking regions and subsequent conversion to PCR-based SSR markers. The designed primer pairs were standardized for PCR amplification, and then validated for utility as genetic markers using panels of elite coffee genotypes, a mapping population for linkage studies, and related taxa of coffee for cross-species transferability. In addition, sequence data of the screened and putative SSR-positive selected clones were used to assess the relative abundance of different SSR motifs in robusta coffee genome. In total 44 new highly informative SSR markers are developed.</p>
         <sec>
            <st>
               <p>Screening/Identification of SSR positive genomic sequences from the small insert partial genomic library of Sln-274</p>
            </st>
            <p>The small-insert partial genomic library constructed from robusta variety Sln-274 comprised 15,744 clones. Radioactive screening of the arrayed and blotted clones indicated 446 putative positives of which good quality sequence data could be obtained for 199 clones. The average insert size of the sequenced clones was 773.5 bp. Considering the latter, and that the sequenced clones represented a random sample of the genomic library with respect to the size, the total size of the cloned genome amounted to 12.2 Mb which equaled to ca. 1.5 % of the robusta coffee genome <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> (Table <tblr tid="T1">1</tblr>). SSR search of the clone sequences using the MISA search module, detected 76 genuine SSR-positive clones (0.48% of the total library) containing both targeted and non-targeted SSR motifs. Overall, these clones contained 92 SSRs comprising DNRs (48.3%), TNRs (25.9%), and HO-NRs (4.8%), and 24 SSRs comprising only MNRs (20.7%) (Table <tblr tid="T1">1</tblr>, <tblr tid="T2">2</tblr>). Among the targeted repeat motifs (screened SSR-oligo nucleotides), AG was the most abundant repeat (26.7%), followed by AC (12.9%) and AGC (7.8%), whereas CCG (0.9%) was the least abundant and ACT was not detected at all (Table <tblr tid="T2">2</tblr>). Similarly, among the non-targeted SSR motifs other than MNRs, AT was the most abundant repeat (8.6%, Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Summary statistics of screening of the small-insert partial genomic library of robusta coffee for putative SSR positive clones/sequences and SSRs.</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c cspan="2" ca="left">
                        <p>
                           <b>
                              <it>Summary of Screening/sequencing</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total Number of clones screened (X)</p>
                     </c>
                     <c ca="left">
                        <p>15,744</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of clones selected and sequenced after screening</p>
                     </c>
                     <c ca="left">
                        <p>446 (2.83% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of good quality sequences obtained</p>
                     </c>
                     <c ca="left">
                        <p>199 (1.27% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total number of SSR containing clones (Y)</p>
                     </c>
                     <c ca="left">
                        <p>76 (0.48% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of sequences containing more than 1 SSR core</p>
                     </c>
                     <c ca="left">
                        <p>26 (34.21% of Y)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of sequences containing compound SSRs</p>
                     </c>
                     <c ca="left">
                        <p>15 (12.93% of Y)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of SSR+ sequences used for primer design/synthesis</p>
                     </c>
                     <c ca="left">
                        <p>58 (0.37% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of working primer pairs</p>
                     </c>
                     <c ca="left">
                        <p>53 (0.34% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Average size of the cloned/sequenced insert</p>
                     </c>
                     <c ca="left">
                        <p>773.5 bp</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Haploid genome size of <it>C. canephora </it>[13]</p>
                     </c>
                     <c ca="left">
                        <p>809 Mb</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Estimated genome screened (number of library clones x. average insert size)</p>
                     </c>
                     <c ca="left">
                        <p>12.2 Mb (1.5 % genome equivalent)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>C. canephora </it>genome sequenced (good quality sequences &#215; average insert size)</p>
                     </c>
                     <c ca="left">
                        <p>0.15 Mb (0.01 % of robusta genome)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="2" ca="left">
                        <p>
                           <b>
                              <it>Summary of SSRs identified in the library</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of non-targeted MNRs of minimum 12-mer length (a)</p>
                     </c>
                     <c ca="left">
                        <p>24 (0.15% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of targeted DNRs having a minimum of 6 repeats (b)</p>
                     </c>
                     <c ca="left">
                        <p>46 (0.29% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of non-targeted DNRs having a minimum of 6 repeats (c)</p>
                     </c>
                     <c ca="left">
                        <p>10 (0.06% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total number of DNRs (b+c)</p>
                     </c>
                     <c ca="left">
                        <p>56 (0.36% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Number of targeted TNRs having a minimum of 5 repeats (d)</p>
                     </c>
                     <c ca="left">
                        <p>30 (0.19% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total number of DNRs and TNRs (b+c+d)</p>
                     </c>
                     <c ca="left">
                        <p>86 (0.55% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total Number of non-targeted HO-NRs having a minimum of 5 repeats (e)</p>
                     </c>
                     <c ca="left">
                        <p>6 (0.04% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total Number of DNRs, TNRs and HO-NRs (b+c+d+e)</p>
                     </c>
                     <c ca="left">
                        <p>92 (0.58% of X)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total Number of SSRs (a+b+c+d+e)</p>
                     </c>
                     <c ca="left">
                        <p>116 (0.73% of X)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Summary statistics of distribution and abundance of detected SSRs in the tested genomic library and SSR frequency estimates for robusta coffee genome</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>SSR motif</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>SSRs detected in the library (% of total SSRs)</p>
                     </c>
                     <c ca="left">
                        <p>Mean no. of repeats/SSR (Range of repeat iterations in the SSR core)</p>
                     </c>
                     <c cspan="3" ca="left">
                        <p>Estimated number/distance of SSRs in the robusta coffee genome</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Total SSRs/genome (X = <it>n.a/b</it>)*</p>
                     </c>
                     <c ca="left">
                        <p>SSRs/Mb genome (Y = X/a)</p>
                     </c>
                     <c ca="left">
                        <p>SSR spacing in the genome<sup>@ </sup>(Z = 1000/Y)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p><it><ul>Targeted SSRs </ul></it>(<b>DNRs<sup>T </sup></b>+ <b>TNRs<sup>T</sup></b>)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AG</p>
                     </c>
                     <c ca="left">
                        <p>31(26.7)</p>
                     </c>
                     <c ca="left">
                        <p>10.0 (6 to 29)</p>
                     </c>
                     <c ca="left">
                        <p>2057</p>
                     </c>
                     <c ca="left">
                        <p>2.5</p>
                     </c>
                     <c ca="left">
                        <p>393</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AC</p>
                     </c>
                     <c ca="left">
                        <p>15 (12.9)</p>
                     </c>
                     <c ca="left">
                        <p>8.4 (6 to 14)</p>
                     </c>
                     <c ca="left">
                        <p>995</p>
                     </c>
                     <c ca="left">
                        <p>1.2</p>
                     </c>
                     <c ca="left">
                        <p>812</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>DNRs<sup>T</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>46 (39.7)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>9.6 (6 to 29)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>3053</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>3.8</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>265</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AGC</p>
                     </c>
                     <c ca="left">
                        <p>9 (7.8)</p>
                     </c>
                     <c ca="left">
                        <p>6.8 (5 to 10)</p>
                     </c>
                     <c ca="left">
                        <p>597</p>
                     </c>
                     <c ca="left">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>1354</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ATC</p>
                     </c>
                     <c ca="left">
                        <p>4 (3.5)</p>
                     </c>
                     <c ca="left">
                        <p>5.0 (5)</p>
                     </c>
                     <c ca="left">
                        <p>265</p>
                     </c>
                     <c ca="left">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>3048</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ACG</p>
                     </c>
                     <c ca="left">
                        <p>3 (2.6)</p>
                     </c>
                     <c ca="left">
                        <p>6.7 (5 to 9)</p>
                     </c>
                     <c ca="left">
                        <p>199</p>
                     </c>
                     <c ca="left">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>4063</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ACC</p>
                     </c>
                     <c ca="left">
                        <p>3 (2.6)</p>
                     </c>
                     <c ca="left">
                        <p>5.7 (5 to 7)</p>
                     </c>
                     <c ca="left">
                        <p>199</p>
                     </c>
                     <c ca="left">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>4063</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT</p>
                     </c>
                     <c ca="left">
                        <p>3 (2.6)</p>
                     </c>
                     <c ca="left">
                        <p>5.3 (5 to 6)</p>
                     </c>
                     <c ca="left">
                        <p>199</p>
                     </c>
                     <c ca="left">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>4063</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAC</p>
                     </c>
                     <c ca="left">
                        <p>3 (2.6)</p>
                     </c>
                     <c ca="left">
                        <p>5.0 (5)</p>
                     </c>
                     <c ca="left">
                        <p>199</p>
                     </c>
                     <c ca="left">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>4063</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AGG</p>
                     </c>
                     <c ca="left">
                        <p>2 (1.7)</p>
                     </c>
                     <c ca="left">
                        <p>6.0 (5 to 7)</p>
                     </c>
                     <c ca="left">
                        <p>133</p>
                     </c>
                     <c ca="left">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>6095</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAG</p>
                     </c>
                     <c ca="left">
                        <p>2 (1.7)</p>
                     </c>
                     <c ca="left">
                        <p>5.5 (5 to 6)</p>
                     </c>
                     <c ca="left">
                        <p>133</p>
                     </c>
                     <c ca="left">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>6095</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCG</p>
                     </c>
                     <c ca="left">
                        <p>1 (0.9)</p>
                     </c>
                     <c ca="left">
                        <p>6.0 (6)</p>
                     </c>
                     <c ca="left">
                        <p>66</p>
                     </c>
                     <c ca="left">
                        <p>0.1</p>
                     </c>
                     <c ca="left">
                        <p>12190</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ACT</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>TNRs<sup>T</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>30 (25.9)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>5.9 (5 to 10)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>1991</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>2.5</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>406</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>SSRs<sup>T</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>76 (65.5)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>8.3 (5 to 29)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>5044</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>6.2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>160</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p><it><ul>Non-targeted DNRs </ul></it>(<b>DNRs<sup>NT</sup>)</b></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AT/AT</p>
                     </c>
                     <c ca="left">
                        <p>10 (8.6)</p>
                     </c>
                     <c ca="left">
                        <p>10.3 (6 to 23)</p>
                     </c>
                     <c ca="left">
                        <p>50563<sup>#</sup></p>
                     </c>
                     <c ca="left">
                        <p>62.50</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <it>
                              <ul>Miscellaneous non-targted SSRs</ul>
                           </it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>A/T</p>
                     </c>
                     <c ca="left">
                        <p>21 (18.1)</p>
                     </c>
                     <c cspan="4" ca="left">
                        <p>nc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C/G</p>
                     </c>
                     <c ca="left">
                        <p>3 (2.6)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>Note: Three of these MNRs were detected as part of the compound SSR motifs</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAAT</p>
                     </c>
                     <c ca="left">
                        <p>2 (1.7)</p>
                     </c>
                     <c ca="left">
                        <p>Nc</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAGTGG</p>
                     </c>
                     <c ca="left">
                        <p>2 (1.7)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AATT</p>
                     </c>
                     <c ca="left">
                        <p>1 (0.7)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAAAAT</p>
                     </c>
                     <c ca="left">
                        <p>1 (0.7)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>DNRs<sup>T+NT</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>56 (48.3)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>11.5 (6 to 29)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>53616</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>66.3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>DNRs<sup>T+NT </sup>&amp; TNRs<sup>T</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>86 (74.1)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>9.5 (5 to 29)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>55607</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>68.7</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>nc: Not calculated</p>
                  <p>*: X = estimated number of SSRs in genome; n = No. of detected SSRs in the library; a = 809 Mb -size of the haploid robusta genome [13]; b = 12.19 Mb- size of the screened robusta genome (see table 1)</p>
                  <p><sup>#</sup>: b = 0.16 Mb -size of genome sequenced</p>
                  <p><sup>@</sup>: Distance (in Kb) between two consecutive SSRs</p>
                  <p><sup>T</sup>: Targeted SSRs; <sup>NT</sup>: Non-targeted SSRs</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Frequency and distribution of SSRs in coffee genome</p>
            </st>
            <p>A total of 76 targeted SSRs (DNRs and TNRs) and 10 non-targeted DNRs were assessed for their lengths, distribution in the present library, and their relative abundance in the robusta genome (Table <tblr tid="T2">2</tblr>). Average length (in terms of repeat units) for the DNRs and TNRs was 9.6 and 5.9, respectively. Among DNRs, AT and AG were comparable and longer than AC, whereas ACG and AGC were the longest of the TNRs (Table <tblr tid="T2">2</tblr>). The size of cloned/screened genomic library and the observed data for identified SSRs were considered along with the earlier predicted size of the robusta genome <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> to derive relative estimates for frequency/distribution of different SSR motifs in the robusta genome. The analysis revealed coffee genome to be enriched in AT type DNRs (AT-DNR), which were estimated to be many fold more than any other SSR motifs (targeted and/or non-targeted). The results indicated one AT-DNR per 16 Kb (1/16 Kb) of robusta genome; this was almost 20-fold higher than the next most abundant DNR <it>i.e</it>. AG (ca. 1/393 Kb). The DNRs as a single class were estimated to be 1/15 Kb genome when AT (comprising 94% of the total DNRs) was included, and 1/265 Kb coffee genome for the remaining ones. In comparison, the overall frequency of TNRs was calculated to be 1/406 Kb with AGC being the most predominant (ca. 1/1300 Kb) and CCG the least (ca. 1/12200 Kb). In addition, a few other higher order SSRs (mainly the AT-rich) were also detected but these were not used for estimate calculations, as their numbers were very low. Thus, the present study indicated an abundance of one SSR (either DNR or TNR) per 15 Kb of robusta coffee genome, wherein the DNRs were ~27 times more abundant than the TNRs.</p>
         </sec>
         <sec>
            <st>
               <p>Development of microsatellite markers</p>
            </st>
            <p>All the identified SSR-positive sequences were tried to design primer pairs for conversion to microsat markers using 'SSR motif length' (of &#8805; 7 and 5 repeats for DNRs and higher order SSRs, respectively) as one major criterion. As a result, only 56 of the total 92 identified SSRs (all except MNRs) were found suitable for primer design indicating 60.9% primer suitability. These comprised 42.2% DNRs, 40.7% compound SSRs, 6.8% TNRs, 5.1% TtNRs and 1.7% HNRs. In addition, primers were also designed for 2 of the randomly chosen 14 MNRs to test their potential for conversion to SSR markers. Among the SSRs found unsuitable for primer design, 70.6% had shorter motif length and 29.4% had flanking regions unsuitable for primer modeling. Of the 58 potential primer pairs designed, 52 could be successfully amplified and 44 of these could further be validated (Table <tblr tid="T3">3</tblr>, <tblr tid="T4">4</tblr>) as useful markers indicating ~76% primer to marker conversion ratio.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Details of the newly developed SSR primers</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c ca="left">
                        <p>Sl. No.</p>
                     </c>
                     <c ca="left">
                        <p>Primer Id</p>
                     </c>
                     <c ca="left">
                        <p>Primer sequence (F: Forward; R: reverse)</p>
                     </c>
                     <c ca="left">
                        <p>Repeat unit</p>
                     </c>
                     <c ca="left">
                        <p>Ta (&#176;C)</p>
                     </c>
                     <c ca="left">
                        <p>Amplicon (bp)</p>
                     </c>
                     <c ca="left">
                        <p>GenBank accession No.</p>
                     </c>
                     <c ca="left">
                        <p>Linkage group</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>CaM02</p>
                     </c>
                     <c ca="left">
                        <p>F: CGCCAGCCACAGCCACTTGC</p>
                     </c>
                     <c ca="left">
                        <p>(AGG)7</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>224</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526557">EU526557</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GCGGGGGTAAGAAAGAGGCGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>CaM03</p>
                     </c>
                     <c ca="left">
                        <p>F: CGCGCTTGCTCCCTCTGTCTCT</p>
                     </c>
                     <c ca="left">
                        <p>(AC)11</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>173</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526558">EU526558</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG03</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TGGGGGAGGGGCGGTGTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>CaM06</p>
                     </c>
                     <c ca="left">
                        <p>F: ACCCGATATTCAACCGACATGC</p>
                     </c>
                     <c ca="left">
                        <p>(CT)7</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>278</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526559">EU526559</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CATGACTTGAGCGCTAATATTTGAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>CaM08</p>
                     </c>
                     <c ca="left">
                        <p>F: CAGCTGAAGTGGTGAAAAACAAGAG</p>
                     </c>
                     <c ca="left">
                        <p>(TC)8</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>202</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526560">EU526560</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGCTTTCTTGTTTTCTCCATTTCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>CaM09</p>
                     </c>
                     <c ca="left">
                        <p>F: CAGGAAGAGAAGAAAGTGAAATTGAC</p>
                     </c>
                     <c ca="left">
                        <p>(TC)8</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>137</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526560">EU526560</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGCTTTCTTGTTTTCTCCATTTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>CaM11</p>
                     </c>
                     <c ca="left">
                        <p>F: GTCCCCGCTTAAATAATATACACACA</p>
                     </c>
                     <c ca="left">
                        <p>(AC)8&#8211;15 bp-AC(6)(AT)6</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>285</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526561">EU526561</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: ATAGGACGGAGGGAGTAATAGAATAAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>CaM12</p>
                     </c>
                     <c ca="left">
                        <p>F: TTCGGGCTCACCTGGCAG</p>
                     </c>
                     <c ca="left">
                        <p>(CAG)10</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>155</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526562">EU526562</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGCGGAAGCAGGACATGGATT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>CaM13</p>
                     </c>
                     <c ca="left">
                        <p>F: CCTCGCCCTCAATCACCTCCTAG</p>
                     </c>
                     <c ca="left">
                        <p>(AAAT)5</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>287</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526563">EU526563</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GGCTCCCCAAGAATCCTCAACTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>CaM15</p>
                     </c>
                     <c ca="left">
                        <p>F: AGCCCTAGACGAGATGGATTCC</p>
                     </c>
                     <c ca="left">
                        <p>(CAG)5</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>170</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526564">EU526564</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGGCTCCTTCTGCACTCCCATTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>CaM16</p>
                     </c>
                     <c ca="left">
                        <p>F: AAGGCAGCTGAAGCGGGACAAA</p>
                     </c>
                     <c ca="left">
                        <p>(TC)11</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>199</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526565">EU526565</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG11</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TGGGGAGAGCTGCAGTTGGAGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>CaM17</p>
                     </c>
                     <c ca="left">
                        <p>F: CGGGCGTTTCTTCTTTTGAGTTGC</p>
                     </c>
                     <c ca="left">
                        <p>(GTC)6</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>212</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526566">EU526566</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TCACGGTTTCTCAAGTCGGGGATTTA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>CaM18</p>
                     </c>
                     <c ca="left">
                        <p>F: CCGACTTGGACTGATGCGAAATTGA</p>
                     </c>
                     <c ca="left">
                        <p>(TC)9</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>181</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526567">EU526567</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: AAAGCAAAAAACCAGAAAACACGAAGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>CaM20</p>
                     </c>
                     <c ca="left">
                        <p>F: GAAACCGCTGAAATTCGGTA</p>
                     </c>
                     <c ca="left">
                        <p>(TATGGG)3</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>217</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526568">EU526568</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG16</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCTCTGATTTCTCCTTTCATC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>CaM21</p>
                     </c>
                     <c ca="left">
                        <p>F: GGGCTTACCGACCGCTCACAG</p>
                     </c>
                     <c ca="left">
                        <p>(TC)8</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>161</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526569">EU526569</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCGCTATTGTTGCTGCTATGGAGTTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>CaM22</p>
                     </c>
                     <c ca="left">
                        <p>F: CCCCTCCTCCTCCTACTAGATGGTGGT</p>
                     </c>
                     <c ca="left">
                        <p>(AT)15</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>113</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526570">EU526570</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG02</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GGTCCAGGGTCCATCCATTCTTGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>CaM23</p>
                     </c>
                     <c ca="left">
                        <p>F: TGCTTGTAAGGGAATTTCTGGTCAG</p>
                     </c>
                     <c ca="left">
                        <p>(AATT)5</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>154</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526571">EU526571</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GTGCGAATGTGGAACCTTTTAAGTCA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>CaM24</p>
                     </c>
                     <c ca="left">
                        <p>F: GGATTCGACAAGGTTGGCAGAGC</p>
                     </c>
                     <c ca="left">
                        <p>(CCT)5&#8211;87 bp-(CTG)6</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>193</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526572">EU526572</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TGCCGAAGAAGAGGGAGATAGTGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>CaM25</p>
                     </c>
                     <c ca="left">
                        <p>F: TCCATCTTCCTTCATTTCTGCTGCTAA</p>
                     </c>
                     <c ca="left">
                        <p>(GA)9</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>186</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526573">EU526573</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCTTCACCCCCTTTGCACTTCCTTA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>CaM26</p>
                     </c>
                     <c ca="left">
                        <p>F: CGTTGCCATTTCTTCCCTTCTTTCTTC</p>
                     </c>
                     <c ca="left">
                        <p>(TG)7&#8211;21 bp-(GA)9</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>236</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526574">EU526574</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: ACACCTTACCCCCTTATCGTTTAGAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>CaM27</p>
                     </c>
                     <c ca="left">
                        <p>F: AAGAGTGTTTGGGATTGCATTTTTAT</p>
                     </c>
                     <c ca="left">
                        <p>(TA)7(GT)14</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>178</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526575">EU526575</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCGCGTAGGCTTTGTTTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p>CaM30</p>
                     </c>
                     <c ca="left">
                        <p>F: TTGCCTTCCGGATTTTTGATTCA</p>
                     </c>
                     <c ca="left">
                        <p>(CA)6(TA)5</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>222</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526576">EU526576</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: AGTTCTAAGGCTGAGGCGGCTAAAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>CaM31</p>
                     </c>
                     <c ca="left">
                        <p>F: ATCCACTGCTGTCACCTTTTGTTA</p>
                     </c>
                     <c ca="left">
                        <p>(TAA)5</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>261</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526577">EU526577</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: AGCAGTGTGTGTGTTAAAGAGGAGTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>CaM32</p>
                     </c>
                     <c ca="left">
                        <p>F: CAGACAGACCAGAGAGAGACACCTAAC</p>
                     </c>
                     <c ca="left">
                        <p>(TA)12</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>204</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526577">EU526577</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG12</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCCCTCCAAAATAATTCAGAAAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>CaM33</p>
                     </c>
                     <c ca="left">
                        <p>F: GCGCATTAGGCGTGGGAGAA</p>
                     </c>
                     <c ca="left">
                        <p>(A)13&#8211;5 bp-(AG)18</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>240</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526578">EU526578</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CAGAGGTTGTCGGTCAGGTGGAGAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>CaM34</p>
                     </c>
                     <c ca="left">
                        <p>F: CTCCAAATTATTAAGCACAACAAACAA</p>
                     </c>
                     <c ca="left">
                        <p>(GA)10</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>202</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526579">EU526579</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: ATCCGCCTCCAGGTCTTATCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>CaM35</p>
                     </c>
                     <c ca="left">
                        <p>F: CGAGCTAGAATGGATGACTTGGTTGG</p>
                     </c>
                     <c ca="left">
                        <p>(TGGAAG)5</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>203</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526580">EU526580</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG04</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GTTGCTCGCACCCGCTTCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p>CaM36</p>
                     </c>
                     <c ca="left">
                        <p>F: TGGTTTTAGTTTGTTTATTTTGATGTGAT</p>
                     </c>
                     <c ca="left">
                        <p>(TTA)7</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>185</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526581">EU526581</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGAGCCCTCCCCTTGCA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>CaM38</p>
                     </c>
                     <c ca="left">
                        <p>F: GAAGCTGAAGCGGGAGGGTAGTAATT</p>
                     </c>
                     <c ca="left">
                        <p>(G)13(GA)7</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>228</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526582">EU526582</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCATCCACCCAACCTTCATTTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>CaM39</p>
                     </c>
                     <c ca="left">
                        <p>F: GAGCAGAGGGAGACGGTGTGGT</p>
                     </c>
                     <c ca="left">
                        <p>(GA)12</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>196</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526583">EU526583</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGCGCAACTCTTCGAACTCTAACC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p>CaM40</p>
                     </c>
                     <c ca="left">
                        <p>F: TTGACACGAAACAGGAAATAAATATAG</p>
                     </c>
                     <c ca="left">
                        <p>(CGA)8</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>238</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526584">EU526584</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCTTCCCCTCATAGCCCTTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p>CaM41</p>
                     </c>
                     <c ca="left">
                        <p>F: CATCGTCTCCATCGTTGCTCTATC</p>
                     </c>
                     <c ca="left">
                        <p>(TAAA)5</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>242</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526585">EU526585</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCTCCCCCTCTTTCCTATCTAAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>32</p>
                     </c>
                     <c ca="left">
                        <p>CaM42</p>
                     </c>
                     <c ca="left">
                        <p>F: TGGGTCAAGGATCCGTGTAAGAAAGA</p>
                     </c>
                     <c ca="left">
                        <p>(CT)8</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>191</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526586">EU526586</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG01</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCTCACCAGTTCCCGATGTCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p>CaM43</p>
                     </c>
                     <c ca="left">
                        <p>F: CCTGACCGTGAACCTGACCGTGAC</p>
                     </c>
                     <c ca="left">
                        <p>(CT)8</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>202</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526587">EU526587</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TCGGGACTTGTTTTGGTTTTTGGGT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p>CaM44</p>
                     </c>
                     <c ca="left">
                        <p>F: TGCTCTTGCCCTCTTTCATCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>222</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526588">EU526588</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG09</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TCCCGAAAAAGAAAATAAGATAAAGAG</p>
                     </c>
                     <c ca="left">
                        <p>(CT)9</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>35</p>
                     </c>
                     <c ca="left">
                        <p>CaM45</p>
                     </c>
                     <c ca="left">
                        <p>F: CGCGGCCAGTGAATTCGAGCTC</p>
                     </c>
                     <c ca="left">
                        <p>(GT)8(GA)5</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>218</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526589">EU526589</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TCGCCATTTGGAGCTGCTGATTCA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>36</p>
                     </c>
                     <c ca="left">
                        <p>CaM46</p>
                     </c>
                     <c ca="left">
                        <p>F: TGGTGCGGTGTTTTTCAGTTTGGAGA</p>
                     </c>
                     <c ca="left">
                        <p>(AT)9 (AC)12</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>222</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526590">EU526590</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CLG11</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: AACCACCCACGCCCACCAATTAAAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>37</p>
                     </c>
                     <c ca="left">
                        <p>CaM49</p>
                     </c>
                     <c ca="left">
                        <p>F: CCGGTTAATACATTGGTCTTT</p>
                     </c>
                     <c ca="left">
                        <p>(A)33</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>200</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526591">EU526591</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: ATGACATTGTTGACTTTGCTATAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>38</p>
                     </c>
                     <c ca="left">
                        <p>CaM52</p>
                     </c>
                     <c ca="left">
                        <p>F: TGCCACTCGGAGCTCACTTCA</p>
                     </c>
                     <c ca="left">
                        <p>(CCG)6</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>160</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526592">EU526592</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GGCTGCCGAGGTTCCAATT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>39</p>
                     </c>
                     <c ca="left">
                        <p>CaM53</p>
                     </c>
                     <c ca="left">
                        <p>F: TTAGGTGTGAGGAGGGATGGGACTG</p>
                     </c>
                     <c ca="left">
                        <p>(GGC)9</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>172</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526593">EU526593</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCACAGACTCCTCGTTCGGCAATC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>40</p>
                     </c>
                     <c ca="left">
                        <p>CaM54</p>
                     </c>
                     <c ca="left">
                        <p>F: ACGGGTGAGTCGAAGGGGGAGCAGT</p>
                     </c>
                     <c ca="left">
                        <p>(GGCAGA)4&#8211;22 bp-(GCA)9</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>185</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526593">EU526593</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CACGCCGGCCCACATCTCGAAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>41</p>
                     </c>
                     <c ca="left">
                        <p>CaM55</p>
                     </c>
                     <c ca="left">
                        <p>F: ATGGGGGGTGTCGGTCTATGTGA</p>
                     </c>
                     <c ca="left">
                        <p>(GA)4(G)4 (A)27</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>183</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526594">EU526594</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGCAATTCGCTGTCACCTCCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>42</p>
                     </c>
                     <c ca="left">
                        <p>CaM57</p>
                     </c>
                     <c ca="left">
                        <p>F: CGAACTCGAACTCAAGCTCAGA</p>
                     </c>
                     <c ca="left">
                        <p>(TA)23</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>190</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526595">EU526595</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: AAGGATATATACGGTAATTTTA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>43</p>
                     </c>
                     <c ca="left">
                        <p>CaM58</p>
                     </c>
                     <c ca="left">
                        <p>F: ACCCCCTCTCCCTCTCCATTTTTAC</p>
                     </c>
                     <c ca="left">
                        <p>CAGA(CA)7</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>192</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526596">EU526596</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GCACGAGGATGGAGCAGAGCACT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>44</p>
                     </c>
                     <c ca="left">
                        <p>CaM59</p>
                     </c>
                     <c ca="left">
                        <p>F: AAGTGAGTGGTTGTGGCATTAAAT</p>
                     </c>
                     <c ca="left">
                        <p>GATA(GA)8</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c ca="left">
                        <p>229</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU526591">EU526591</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>--</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TTCTTACAAAATCTCATCCCCTCAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>CaM: <b><it>Ca</it></b>nephora <b><it>M</it></b>icrosatellite marker; '--': Unmapped; these were not polymorphic among parents of the tested mapping population; CLG: Combined Linkage Group (as per [13]). The amplicon size is based on the original clone of Sln-274 genomic library from which the marker was designed.</p>
               </tblfn>
            </tbl>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Allelic diversity attributes of new SSR markers as revealed across elite genotypes of arabica and robusta, and related coffee taxa</p>
               </caption>
               <tblbdy cols="19">
                  <r>
                     <c ca="left">
                        <p>Primer Id</p>
                     </c>
                     <c cspan="6" ca="center">
                        <p><it>C. arabica </it>(n = 8)</p>
                     </c>
                     <c cspan="6" ca="center">
                        <p><it>C. canephora </it>(n = 8)</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p><it>Coffea </it>spp. (n = 12)</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p><it>Psilanthus </it>spp. (n = 2)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6">
                        <hr/>
                     </c>
                     <c cspan="6">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>N<sub>A</sub></p>
                     </c>
                     <c ca="left">
                        <p>PA<sup>$</sup></p>
                     </c>
                     <c ca="left">
                        <p>Allele range</p>
                     </c>
                     <c ca="left">
                        <p>H<sub>o</sub></p>
                     </c>
                     <c ca="left">
                        <p>H<sub>e</sub></p>
                     </c>
                     <c ca="left">
                        <p>PIC</p>
                     </c>
                     <c ca="left">
                        <p>N<sub>A</sub></p>
                     </c>
                     <c ca="left">
                        <p>PA<sup>$</sup></p>
                     </c>
                     <c ca="left">
                        <p>Allele range</p>
                     </c>
                     <c ca="left">
                        <p>H<sub>o</sub></p>
                     </c>
                     <c ca="left">
                        <p>H<sub>e</sub></p>
                     </c>
                     <c ca="left">
                        <p>PIC</p>
                     </c>
                     <c ca="left">
                        <p>N<sub>A</sub></p>
                     </c>
                     <c ca="left">
                        <p>PA<sup>$</sup></p>
                     </c>
                     <c ca="left">
                        <p>Allele range</p>
                     </c>
                     <c ca="left">
                        <p>N<sub>A</sub></p>
                     </c>
                     <c ca="left">
                        <p>PA<sup>$</sup></p>
                     </c>
                     <c ca="left">
                        <p>Allele range</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="19">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CaM02</p>
                     </c>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>252&#8211;262</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Duplicated loci</p>
                     </c>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>256&#8211;268</p>
                     </c>
                     <c ca="left">
                        <p>0.71</p>
                     </c>
                     <c ca="left">
                        <p>0.69</p>
                     </c>
                     <c ca="left">
                        <p>0.67</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>4<sup>a,c,k,l</sup></p>
                     </c>
                     <c ca="left">
                        <p>252&#8211;278</p>
                     </c>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>262&#8211;272</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CaM03</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>1<sup>6</sup></p>
                     </c>
                     <c ca="left">
                        <p>164&#8211;184</p>
                     </c>
                     <c ca="left">
                        <p>0.38</p>
                     </c>
                     <c ca="left">
                        <p>0.74*</p>
                     </c>
                     <c ca="left">
                        <p>0.70</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>171&#8211;194</p>
                     </c>
                     <c ca="left">
                        <p>0.63</p>
                     </c>
                     <c ca="left">
                        <p>0.88</p>
                     </c>
                     <c ca="left">
                        <p>0.83</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>5<sup>c,e,f,j,l</sup></p>
                     </c>
                     <c ca="left">
                        <p>165&#8211;201</p>
                     </c>
                     <c ca="left">
                        <p>1</p>
    