To identify cis-regulatory proteins involved in transcriptional regulation of 2CPA, a yeast-one-hybrid (Y1H) screen was performed with the 216 bp redox-active 2CPA promoter domain 11 and its flanking regions. The bait element was cloned into the vector pONE-1 upstream of the Gal1,10 minimal promoter and the HIS3-cDNA. The vector was transformed into the yeast strain Y187. Preys were provided by co-transformation of Y187 with a cDNA library derived from an Arabidopsis thaliana cell suspension culture 22. Strongest interaction with the 2CPA promoter DNA was observed with pAct2-clone1, which encodes a fusion protein of the Gal4-activation domain (AD) and the AP2-type transcription factor Rap2.4a (At1g36060; type Ib-ERF) 23 spaced by 11 amino acids (AD-Rap2.4a).

The interaction of the AD-Rap2.4a-fusion protein with the bait was confirmed on media supplemented with 40 mM 3-amino-1,2,4-triazol (3AT), which is an inhibitor of His-biosynthesis. To exclude epigenetic regulation, the yeast strain Y187 was retransformed with E. coli-amplified prey and bait constructs. Survival on 40 mM 3AT confirmed the strong interaction between the transcription factor and the target element.

With five overlapping DNA-fragments (F1, F2, F3, F4 and F5) covering the Y1H-bait, the binding site of Rap2.4a was mapped to the 13 bp overlap of F4 and F5 by EMSA under non-reducing conditions (Fig. 1A). The Rap2.4a target sequence was confirmed with a synthetic double-stranded 13 bp oligonucleotide (Fig. 1B). Heterologously expressed Rap2.6 (At1g43160) (Fig. 1A), which shares 80 % sequence identity with Rap2.4a in the DNA-binding site (Fig. 1C), and control lysates of E. coli, which were transformed with an empty expression vector (data not shown), did not shift any 2CPA promoter fragment. Alternative to monitoring the gel shifts by immunodetection of His-tagged proteins, the interaction between the bait element and Rap2.4a was analysed by detection of biotinylated PCR-products using horseradish peroxidise-coupled streptavidin (data not shown). Here, immunodetection of the proteins was chosen as routine method, since both methods showed the interaction of DNA and proteins, but immunodetection of His-tags turned out to be easier and more efficient to apply.

Pattern analysis by MatInspector 24 predicted a coupling element 3 (CE3)-like motif (CA

CGCG

TG

CE3s often confer ABA-responsiveness along with ACGT-ABREs 2526. For example, TRAB1 can alternatively recognize the two motifs 25 and Rap2.4b can take over DREBP and ERF-function if overexpressed 27. However, Rap2.4a neither bound the ACGT-variant of the CE3 (Mut D, Fig. 1D) nor the ABRE predicted 282 bp upstream of the CE3-like element (Fig. 1D) demonstrating the specificity of Rap2.4a for the CE3-like element.

The regulatory function of Rap2.4a on the 2CPA promoter was tested by transient Rap2.4a over-expression (35S:Rap2.4a) in Arabidopsis mesophyll protoplasts which were transfected with 2CPA_wt:YFP. Standardized on co-transfected 35S:CFP, 16 h Rap2.4a over-expression resulted in ca. 5-fold higher YFP activity than in an empty vector control (Fig. 2A) demonstrating that Rap2.4a is an activating transcription factor.

To test the in vivo function of C₃G₄ of the CE3-like element on Rap2.4a activation of 2CPA transcription, Arabidopsis mesophyll protoplasts were transfected either with reporter constructs expressing YFP under control of the wild-type promoter (2CPA_wt:YFP) or a mutagenized promoter (2CPA_mut:YFP), in which TT substituted for C₃G₄ (Fig. 2B). After normalization on the expression of co-transfected 35S:CFP reference constructs the YFP/CFP expression ratio of the TT-variant (2CPA_mut:YFP) was decreased by 34 % compared to 2CPA_wt:YFP after 16 h incubation (Fig. 2B) confirming the regulatory function of the two nucleotides in stabilization of the interaction between the transcription factor and the promoter, however it did not fully omit 2CPA promoter activation.

Since Rap2.4a lacks a strong nuclear localization signal and chloroplast targeting has been suggested for the Ib-ERF Rap2.4c (At2g22200) 28, the distribution of Rap2.4a protein was analysed in Arabidopsis protoplasts expressing Rap2.4a-YFP fusion proteins by confocal laser scanning microscopy (CLSM) (Fig. 3). After 12 h incubation, the majority of the protein (92 ± 7 %) was observed in the nucleus like for the YFP-fusion protein of the basic helix-loop-helix transcription factor ABI5 (97 ± 2 %), while only 53 ± 5 % of free YFP was detected in the nucleus (Fig. 3).

Luciferase reporter elements have a lower stability and higher sensitivity and time-resolution than fluorescence proteins 29. Hence, redox regulation of the 2CPA promoter was studied in a transgenic 2CPA:luciferase line 11. The luciferase activity was 1.8-fold increased in 35S:Rap2.4a transfected protoplasts compared to 35S:CFP-transfected ones after 2 h incubation (Tab. 1). The quick response demonstrated fast and strong activation of 2CPA by Rap2.4a.

To test the function of Rap2.4a in redox-regulation of 2CPA expression, the cellular redox poise was decreased by application of 1 mM DTT or ascorbate. The antioxidants decreased the luciferase activity in Rap2.4a over-expressing protoplasts by 63 % and 65 %, respectively, within 90 min (Tab. 1). 1 mM H₂O₂ increased the luciferase activity in 35S:Rap2.4a lines by 54 % compared to control conditions (Tab. 1). With H₂O₂-concentrations higher than 3 mM the reporter gene activity decreased again indication inactivation (data not shown). Under control conditions and in 1 mM H₂O₂-treated samples, transfection with Rap2.4a cDNA resulted in 180 % and 203 % of the luciferase activity observed in the CFP transfected protoplasts. It is concluded that Rap2.4a activates the reporter gene. In contrast, the reporter gene activity was decreased in DTT and ascorbate treated samples. This observation suggested that Rap2.4a binding is redox-dependent.

Redox regulation of the Rap2.4a DNA binding was studied with 2 μg Rap2.4a and 100 pmol F5 in presence of either 5 mM DTT or H₂O₂ relative to an untreated control. DNA-binding was analysed fluorometrically by quantitative PCR after separation on agarose gels. In H₂O₂-treated samples 310 ± 90 % of F5 was detected compared to untreated controls. In DTT-treated samples, the amount of free F5 was 730 ± 140 % that of untreated samples (Tab. 2), demonstrating that both, H₂O₂ and DTT abolished DNA binding.

On SDS-PAGE recombinant Rap2.4a separated with apparent molecular masses of 36 kDa, 70 kDa and larger aggregates indicating monomeric, dimeric and oligomeric forms of the transcription factor (Fig. 4). DTT abolished the oligomers, reduced the dimeric fraction and increased the amount of monomer (Fig. 4 left). After application of mild H₂O₂ concentrations (Fig. 4 right) only high molecular weight bands were detected. Treatment with 5 mM H₂O₂ resulted in a complete loss of Rap2.4a signals on the Western-Blots indicating that either high molecular mass complexes were formed, which did not migrate into the gel any more or that large protein aggregates were formed that there were beyond the transfer limits of Western-blotting. To test whether aggregates were formed and whether they were reversible, the samples were treated with 5 mM of the reductant β-mercaptoethanol minutes after the incubation with 5 mM H₂O₂. With β-mercaptoethanol, high amounts of monomeric Rap2.4a were detected demonstrating that H₂O₂ by its own formed reversible high molecular weight complexes (Fig. 4 right).

Cysteine residues are typical targets for redox regulation of proteins. Rap2.4a contains 3 cysteine residues at the positions 113, 286 and 302, which are located outside of the DNA-binding motif (aa 141 – 209) in the N- and C-terminal domains. They are not conserved in the Ib-ERF-subfamily of AP2-family of transcription factors and specific to Rap2.4a (data not shown). By equilibrium-based redox titration the midpoint redox potential of -269 mV was determined for the transition from Rap2.4a monomers to dimers (Fig. 4B). The relative amount of oligomers started to increase at redox potentials higher than -262 mV (Fig. 4B) consistent with the observation that oligomerization occurred at oxidizing conditions (Fig. 4A). Due to the difficulties to blot the aggregates quantitatively (see Fig. 4A) and the high number of different aggregates formed (Fig. 4A), it is impossible to determine the precise redox poise for the induction of aggregation. From the observations presented in Fig. 4A and 4B, it is suggested that it is a gradual multi-step process promoted by highly oxidizing conditions.

Rap2.4a is expressed in roots and shoots (Fig. 5A left). Like the 2CPA transcript amount, Rap2.4a mRNA levels decreased in leaves upon application of 50 mM ascorbate (Fig. 5A middle) and sugars (Fig. 5A right).

The in planta function of Rap2.4a in 2CPA expression was assessed in T-DNA insertion lines of Arabidopsis thaliana. The Rap2.4a gene is interrupted upstream of the AP2-type DNA-binding site (Salk_091212; Rap2.4a-KO). Consequently, Rap2.4a-KO-lines lacked Rap2.4a mRNA (Fig. 5B). From the F2 progeny of the backcross and from the T2 progeny of the Salk-line several independent homozygous lines were selected for analysis.

In the Rap2.4a-KO-lines the 2CPA transcript level was decreased (Fig. 5B and 5C). In parallel, the transcript levels of Csd2, which encodes the major chloroplast Csd (At2g28190), stromal and thylakoid-bound ascorbate peroxidases (sAPx: At4g08390; tAPx: At1g77490), the stress inducible large subunit of the ADP-glucose-pyrophosphorylase (ApL3; At4g39210), the Rieske protein (PetC; At4g03280) and several transcripts encoding subunits of the light-harvesting complex (e.g. Lhcb4.1 (At5g01530), Lhca2.1 (At3g61470) and Lhca5 (At1g45474) were less than in wild-type plants (Fig. 5C). Although 2CPA transcription is suppressed by ascorbate in wild-type plants 11, (Fig. 5B), the transcript level was increased in Rap2.4a-KO lines (Fig. 5B).

The transcript levels of selected genes known to be induced by ROS, e.g. the transcription factor ZAT10 (At1g27730) and the cytosolic ascorbate peroxidase Apx2 (At3g09640) were slightly increased in Rap2.4a-KO, like the transcript levels of plastocyanin (PetE: At1g20340) and the ethylene-inducible DREBP-analogous Rap2.4b (At1g78080; Lin et al., 2007). The transcript amount of three other Ib-ERF transcription factors including the chloroplast targeted Ib-ERF Rap2.4c (At2g22200) 28, and that of chloroplast GR were only by 2 – 19 % decreased compared to wild-type plants.

After adaptation to controlled environmental conditions, the Rap2.4a-KO T-DNA-insertion lines showed only subtile phenotypes: The chlorophyll levels were slightly decreased and the leaf blades were 8 % larger (Fig. 6A and 6B). Three independent sets of 20 plants were pre-cultivated for 6 weeks under controlled conditions (10 h continuously 100 μmol m^-2s^-1). Afterwards, they were transferred to the greenhouse and exposed to naturally fluctuating light conditions. After two changes between two cloudy (maximum light intensity: 80 μmol quanta m^-2 s^-1; 14 h light) and two sunny days (maximum light intensity: 500 μmol quanta m^-2 s^-1; 14 h light), Rap2.4a-KO lines gradually developed stress phenotypes, such as severe chlorosis, stunted, thicker and less branched inflorescences and increased leaf blade areas (Fig. 6C). In average the chlorophyll contents were decreased by 27 ± 15 % (n = 60) compared to wild-type plants and the leaf blade area increased to 183 ± 63 % (n = 60). In total in 47 % of the Rap2.4a-KO plants the chlorophyll content was at least decreased by 50 %. In 61 % of the plants the leaf blade area of the largest 5 leaves was at least twice the size of the largest leaves of wild-type-plants grown in parallel (data not shown).

Plants were grown on a 1:1:1 mixture of vermiculite, pelrite and peat moss at day/night-cycles (14 h light 100 μmol quanta m^-2 s^-1, 24°C and (10 h dark, 18°C) at 55% relative humidity or in the green house at natural fluctuating light conditions (14 day length; cloudy days: 20 – 80 μmol quanta m^-2 s^-1; sunny days: 50 – 500 μmol quanta m^-2 s^-1, 20 – 25°C). Aseptic growth on plates was performed as described in 11.

The redox sensitive 2CPA promoter fragment 11 was amplified by PCR using the primers AAAAACTCGAGCATAATAATGAA and AAAAACTCGAGGCTTCTTCACTTA and cloned into the Xho I site of pONE1 35 to generate the bait construct pONE1-2CPA. The yeast strain Y187 carrying pONE1-2CPA was transformed with 50 Ng of an Arabidopsis thaliana suspension culture cDNA library generated in pAct2 22, selected on SD medium 36 lacking histidine, tryptophan and leucine and supplemented with 1 mM 3-aminotriazole (3AT). The clones were re-screened on SD medium containing 5 – 40 mM 3AT. Plasmids were isolated according to standard protocols 11 and transformed into E. coli TOP10 for further analysis.

Total RNA was isolated as described in 20 and cDNA synthesis and RT-PCR performed in the linear phase of amplification according to 11 and 18 with gene specific primers, whose specificity was controlled by sequencing of the amplification products.

SDS-PAGE was performed as described in 20. For non-reducing gels no DTT was added to the loading buffer. For native gels, the running and loading buffers were prepared without SDS and the samples were not heated prior to sample loading.

The full length cDNAs of Rap2.4a and Rap2.6 were amplified by RT-PCR using the primers Rap2.4-S (ATGGCGGATCTCTTCGGTG), Rap2.4-A (TCACGATAAAATTGAAGCCC), Rap2.6-S (ATGGTGTCTATGCTGACTAATG) and Rap2.6-A (GTTAGTTAACCAAAAGAGGAG), respectively, and cloned into pCR-T7/NT-TOPO (Invitrogen, CA). In 1 l LB cultures of transformed BL21, expression was induced at an optical density of A₆₀₀ = 0.6-0.8 with 2 mM IPTG. After 4 h, the His-tagged proteins were affinity purified on Ni²⁺-NTA agarose resin (Qiagen, Germany).

2.5 μg recombinant proteins and 20 ng DNA were separated on 6–7% native polyacrylamide gels (dilution of Rotiphorese-30 (Roth, Germany) in 0.5X TBE 36 at 100 V until the bromphenolblue dye was migrated approximately 2/3 down the length of the gel. After 20 min incubation in 0.5 × TBE at room temperature it was electrophoretically blotted on nitrocellulose membranes (for protein detection) or Hybond-N⁺ (Amersham Biosciences, UK) (for nucleic acid detection) using a semi-dry blotter. The His-tagged proteins and biotinylated PCR-products were detected with anti-His-antibody (Amersham Biosciences, UK), Light Shift Chemiluminescence EMSA Kit (Pierce, USA) and SuperSignal West Pico Chemiluminescent Substrate (Pierce, USA), respectively, according to the suppliers' protocols.

The promoter region -294 to -721 upstream of 2CPA translation start site was PCR amplified in five fragments using the primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCATGGCATGCATAAGAGTC and GATGACGGAGATGATG for fragment 2, TCTCCGTCATCGAAC and GCAGAGTTTCTGGGT for fragment 3, AAACCATGGAATACCCAGAAACT and GCGTGACCGGAGACATG for fragment 4 and CTCCGGTCACGCGATTCAAC and CTCTCTTCACTTGGTTTAC for fragment 5. To generate double-stranded 13–20 bp DNA fragments, matching synthetic single-stranded oligonucleotides were annealed at room-temperature.

For quantification of the binding affinity, 2 Ng recombinant protein was incubated for 10 min with 100 pmol fragment F5 in 0.5 × TBE or 0.5 × TBE supplemented with 5 mM DTT or H₂O₂ and analysed by agarose gel electrophoresis in 0.5 × TBE for unbound F5. Free F5 was quantified in 5 parallels as described for quantification of RT-PCR products. PCR amplification (10 cycles) was performed with F5 fragments eluted from the 120 – 200 bp region of the gels using the QIAquick Gel Extraction Kit (Quiagen).

Oligonucleotide-directed mutagenesis was performed according to 37 from 2CPA:LUC plasmids 11 with 2CPA-HindIII primer (GATCAATTAAGCTTAGAGTTG) and primer2-R (GTTGAAT

AA

The Rap2.4a cDNA was cloned into Age I and Eco RI sites of 35SCFP-NosT vector 38 replacing CFP. In addition, 35SCFP-NosT vector was re-ligated after Age I/Eco RI digestion to serve as empty vector control. Isolation and saturating transfection of Arabidopsis thaliana mesophyll protoplasts with equal amounts of 35S:Rap2.4a, 35S:CFP-NosT and 2CPA_wt:YFP or 2CPA_mut:YFP plasmid DNA, respectively, was performed as described in 18.

For the localization studies the cDNAs of Rap2.4a and ABI5 39 were N-terminally fused to YFP-cDNA and expressed under the control of the CaMV35S promoter in transfected protoplasts. The distribution of YFP was alternatively quantified from 2D images taken by confocal laser scanning microscopy or using an Ascent FL fluorometer.

The test constructs were transfected into mesophyll protoplasts isolated from the homozygous transgenic Arabidopsis line T19-2 11 and analysed after 3 h in 100 mM sodium-phosphate buffer (pH 7.0) containing 5 mM luciferin (Duchefa) and 6 mM ATP using a Ascent FL luminometer.

Redox titrations were performed with 1 μg His-tagged Rap2.4a according to 6 in 150 μl MES buffer (100 mM) supplemented with 10 mM mixtures of oxidized and reduced DTT adjusted to the respective redox potential by redox titration. At the respective equilibrium, 50 mM iodoacetamide was added, which blocks free sulfhydryl groups, to prevent thiol-disulfide exchange and inhibit post-lysis oxidation of free cysteines. The quaternary structure of Rap2.4a was visualized by non-reducing SDS-gel electrophoresis and subsequent Western blot analysis with anti-His antibody 18. Protein amounts were quantified using the GelScan-software package (BIOSCITEC, Marburg, Germany).

RAP2.4a (Salk_091212) T-DNA insertion lines were obtained from NASC (Loughborough, UK) and analysed for the insertion of the T-DNA in the gene of interest with the primers: Rap2.4-F (ATGGCGGATCTCTTCGGTG), Rap2.4-R1 (TCACGATAAATTGAAGCCC) and a primer for the T-DNA left border salkLBm (TGGACCGCTTGCTGCAAC).

ApL3: At4g39210; APX2: At3g09640, 2CPA: At3g11630, chlGR: At3g54660; Csd2: At2g28190; Lhca2.1: At3g61470; Lhca5: At1g45474; Lhcb2.2: At2g05070; PetC: At4g03280; PetE: At1g76100; Rap2.4a: At1g36060; Rap2.4b: At1g78080; Rap2.4c: At2g2220; Rap2.4d: At1f22190; Rap2.4e: At4g39780; sAPx: At4g08390; tAPx: At1g77490; ZAT10: At1g27730