<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2202-9-61</ui>
   <ji>1471-2202</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Time-dependent biphasic modulation of human BDNF by antidepressants in neuroblastoma cells</p>
         </title>
         <aug>
            <au id="A1" ce="yes">
               <snm>Donnici</snm>
               <fnm>Lorena</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>lory80@hotmail.com</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Tiraboschi</snm>
               <fnm>Ettore</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>ettore.tiraboschi@helsinki.fi</email>
            </au>
            <au id="A3">
               <snm>Tardito</snm>
               <fnm>Daniela</fnm>
               <insr iid="I1"/>
               <email>daniela.tardito@unimi.it</email>
            </au>
            <au id="A4">
               <snm>Musazzi</snm>
               <fnm>Laura</fnm>
               <insr iid="I1"/>
               <email>laura.musazzi@unimi.it</email>
            </au>
            <au id="A5">
               <snm>Racagni</snm>
               <fnm>Giorgio</fnm>
               <insr iid="I1"/>
               <email>giorgio.racagni@unimi.it</email>
            </au>
            <au id="A6" ca="yes">
               <snm>Popoli</snm>
               <fnm>Maurizio</fnm>
               <insr iid="I1"/>
               <email>maurizio.popoli@unimi.it</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Center of Neuropharmacology, Department of Pharmacological Sciences and Center of Excellence on Neurodegenerative Diseases, University of Milano, Italy</p>
            </ins>
            <ins id="I2">
               <p>Axxam SpA, San Raffaele Biomedical Science Park, Milano, Italy</p>
            </ins>
            <ins id="I3">
               <p>Sigrid Jus&#233;lius Laboratory, Neuroscience Center, University of Helsinki, Finland</p>
            </ins>
         </insg>
         <source>BMC Neuroscience</source>
         <issn>1471-2202</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>61</fpage>
         <url>http://www.biomedcentral.com/1471-2202/9/61</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18601743</pubid>
               <pubid idtype="doi">10.1186/1471-2202-9-61</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>15</day>
               <month>2</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>05</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>05</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Donnici et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Recent rodent studies reported that antidepressant treatments affect the expression of brain-derived neurotrophic factor (BDNF) mRNA in a way that is dependent on treatment duration, by selective modulation of different BDNF transcripts. However, no data are available for the human BDNF gene. We studied the effect of different antidepressants on BDNF mRNA expression in human neuroblastoma SH-SY5Y cells.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Cultured cells were treated with the antidepressants fluoxetine, reboxetine and desipramine for different time lengths (6, 24, 48 hours). Expression of total BDNF mRNA was analyzed by reverse transcription PCR and levels of different BDNF transcripts were detected by hemi-nested PCR with specific primers.</p>
               <p>Short-term treatment (6 hours) with reboxetine or desipramine reduced total BDNF, whereas long-term treatment (48 hours) significantly increased total BDNF mRNA levels. These changes were accounted for by differential regulation of BDNF IV and VIa/b transcripts. Fluoxetine showed no significant effects.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>This is the first study showing biphasic changes in the expression of total and specific BDNF transcripts in human cells following antidepressant treatments. These findings suggest that biphasic induction of BDNF by antidepressants could be a feature common to rodents and humans and encourage the use of SH-SY5Y cells as a tool for investigation of drug effects on human genes.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Brain-derived neurotrophic factor (BDNF) has been implicated in both the pathophysiology and pharmacotherapy of depression <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. It has been shown that BDNF expression and/or function is impaired in major depression or following stress paradigms, while it is up-regulated by physical exercise and antidepressants. However, different and sometimes conflicting findings have been reported <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, showing that antidepressants change total BDNF expression level depending on length of the treatment and time interval following administration. Indeed, independent investigations showed that short-term antidepressant treatment decreased BDNF expression in rodents, whereas long-term treatment increased BDNF <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>.</p>
         <p>The increasing knowledge of BDNF gene in rodents <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp> has encouraged the research on the modulation of different BDNF transcripts by pharmacological treatments. Recent studies showed that different drugs, lengths of treatment and drug/physical exercise combination, as well as stress paradigms, may selectively influence the transcription of specific BDNF transcripts in rodents <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>However, to the best of our knowledge no data are available yet on the effect of antidepressants on human BDNF transcripts <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. In addition, the gene structure of human BDNF has been recently revised. Accordingly, the human BDNF gene contains ten upstream untranslated exons (numbered I, II, III, IV, V, Vh, VI, VII, VIII, and VIIIh) that are alternatively spliced to a common downstream exon IX containing the coding region and the 3' untranslated region (see Figure <figr fid="F1">1</figr>). Therefore, aim of the present study was to investigate whether antidepressant treatments of different time lengths induce changes in the expression of BDNF gene also in cultured human cells and to assess whether these modifications could be explained by differential regulation of BDNF transcripts. Therefore, total BDNF mRNA and distinct BDNF transcript levels were measured by semi-quantitative PCR after treatment with different antidepressant drugs in human neuroblastoma SH-SY5Y cells.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Schematic representation of human BDNF gene and of primers used</p>
            </caption>
            <text>
               <p>
                  <b>Schematic representation of human BDNF gene and of primers used.</b>
               </p>
            </text>
            <graphic file="1471-2202-9-61-1"/>
         </fig>
         <sec>
            <st>
               <p>Experimental Procedures</p>
            </st>
            <sec>
               <st>
                  <p>Cell culture and pharmacological treatment</p>
               </st>
               <p>Human neuroblastoma SH-SY5Y cells were obtained from Interlab Cell Line Collection (Genova, Italy), at passage P14; only cells between passages P16 to P25 were used. Cells were grown in Minimum Essential Medium (Invitrogen, Carlsbad, CA), containing 10% foetal bovine serum, 2 mM glutamine and non-essential aminoacids (1 mg/l) in a humidified incubator (95% air, 5% CO<sub>2</sub>) at 37&#176;C. Cells were treated for 6, 24 and 48 hours before harvesting (all cells were kept in culture for 3 days total) with different antidepressants: the selective serotonin reuptake inhibitor fluoxetine (FLX), the selective norepinephrine reuptake inhibitor reboxetine (RBX) and the tricyclic antidepressant desipramine (DMI), predominantly inhibiting norepinephrine reuptake (all 10 &#956;M, final concentration).</p>
            </sec>
            <sec>
               <st>
                  <p>RNA isolation, cDNA synthesis and reverse transcription-PCR for total BDNF expression</p>
               </st>
               <p>Cells from twelve independent experiments were lysed with Trizol (Invitrogen) and total RNA was isolated with Phase Lock Gel Heavy (Eppendorf, Hamburg, Germany). RNA purity was confirmed by spectrophotometry (A<sub>260</sub>/A<sub>280</sub>>1.7) and RNA integrity was visualized by agarose gel electrophoresis. 4 &#956;g of RNA were reverse transcribed using cloned AMV first-strand synthesis kit (Invitrogen) and random hexamers. In order to detect total BDNF, PCR was performed with primers designed on the sequence of the coding exon, exon IX (exIX fwd and exIX rev3 primers) (Table <tblr tid="T1">1</tblr> and Figure <figr fid="F1">1</figr>): 5 min 95&#176;C, 33 cycles of 95&#176;C for 15 s, 58&#176;C for 10 s and 72&#176;C for 30 s. BDNF exon IX primers were used in the same reaction tube together with primers for the housekeeping Ubiquitin C (UBC) gene <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> (Table <tblr tid="T1">1</tblr>), in order to co-amplify the target gene and the internal standard, which did not vary throughout experiments. The number of cycles and primer concentrations were chosen experimentally in order to fall into the exponential phases of the amplification reaction. For semi-quantitative analysis, amplicons were detected by gel electrophoresis (8% acrylamide, ethidium bromide staining). Bands were acquired with Bio-Rad GelDoc System (Bio-Rad Laboratories, CA) and intensities were measured with Quantity One software (Bio-Rad Laboratories). All the PCR amplicons were sequenced and found to mirror expected sequences for the different transcripts (not shown). The intensities of the PCR products of BDNF total mRNA were normalized on the intensity of the house-keeping gene UBC and then the data were reported as ratio between treated cells and control cells. For statistical analysis two-way analysis of variance (ANOVA) was performed followed by Bonferroni post-hoc tests.</p>
               <tbl id="T1">
                  <title>
                     <p>Table 1</p>
                  </title>
                  <caption>
                     <p>Sequences of primers used for RT-PCR.</p>
                  </caption>
                  <tblbdy cols="2">
                     <r>
                        <c ca="center">
                           <p>
                              <b>Primers</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>Sequence</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="2">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>UBC fwd</p>
                        </c>
                        <c ca="center">
                           <p>atttgggtcgcggttcttg</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exI fwd</p>
                        </c>
                        <c ca="center">
                           <p>cacttgagtctccaggacagc</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exII fwd</p>
                        </c>
                        <c ca="center">
                           <p>caacggatttgtccgaggtgg</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exIII fwd</p>
                        </c>
                        <c ca="center">
                           <p>atgcctcactgagcccagttcc</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exIV fwd</p>
                        </c>
                        <c ca="center">
                           <p>cggagcagctgccttgatgg</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exVIa/b fwd</p>
                        </c>
                        <c ca="center">
                           <p>ctggagccagaatcggaacc</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exVII fwd</p>
                        </c>
                        <c ca="center">
                           <p>aacccacatctctacccatcc</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exVIb-IXbd fwd</p>
                        </c>
                        <c ca="center">
                           <p>ggaagaaggagaacttgaagc</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exIX fwd</p>
                        </c>
                        <c ca="center">
                           <p>actctggagagcgtgaatgg</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>UBC rev</p>
                        </c>
                        <c ca="center">
                           <p>tgccttgacattctcgatggt</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>atccaacagctcttctatcacg</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exIX rev2</p>
                        </c>
                        <c ca="center">
                           <p>atactgtcacacacgctcagc</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>exIX rev3</p>
                        </c>
                        <c ca="center">
                           <p>cgtagaagtattgcttcagttgg</p>
                        </c>
                     </r>
                  </tblbdy>
               </tbl>
            </sec>
            <sec>
               <st>
                  <p>RNA isolation, cDNA synthesis and reverse transcription-PCR for BDNF isoforms</p>
               </st>
               <p>RNA was extracted as above from cells of six independent experiments. 8 &#956;g of RNA were reverse transcribed using cloned AMV first-strand synthesis kit (Invitrogen) and 2 pmoles of the BDNF specific primer exIX rev3 (Table <tblr tid="T1">1</tblr>), in order to increase the specificity of the reaction. Due to the low level of some transcripts, semi-quantitative hemi-nested PCR was used to detect specific BDNF exons <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Figure <figr fid="F1">1</figr> and Tables <tblr tid="T1">1</tblr> and <tblr tid="T2">2</tblr> show human BDNF transcripts and primers used. To preamplify transcripts, a first PCR was performed (5 min 95&#176;C, 15 cycles of 95&#176;C for 15 s, 58&#176;C for 10 s and 72&#176;C for 30 s) using exIX rev2 and forward primers specific for individual BDNF transcripts. The second PCR was carried out with 2 &#956;l of the first PCR products, using the reverse primer exIX rev1 and specific forward primers. The number of cycles and primer concentrations were chosen experimentally in order to fall into the exponential phases of the amplification reaction (between 20 and 30 cycles). UBC was used as internal control. Measurement of band intensities, normalization of data and statistical analysis were as described for total BDNF.</p>
               <tbl id="T2">
                  <title>
                     <p>Table 2</p>
                  </title>
                  <caption>
                     <p>Human BDNF transcripts and specific primers used for RT-PCR.</p>
                  </caption>
                  <tblbdy cols="4">
                     <r>
                        <c ca="center">
                           <p>
                              <b>Transcript</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>Accession number</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>Primers</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>Product (bp)</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="4">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF I</p>
                        </c>
                        <c ca="center">
                           <p>EF689021.1</p>
                        </c>
                        <c ca="center">
                           <p>exI fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>269</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF II</p>
                        </c>
                        <c ca="center">
                           <p>EF674517.1; EF674518.1; EF674519.1</p>
                        </c>
                        <c ca="center">
                           <p>exII fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>301</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF III</p>
                        </c>
                        <c ca="center">
                           <p>EF674520.1</p>
                        </c>
                        <c ca="center">
                           <p>exIII fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>254</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF IV</p>
                        </c>
                        <c ca="center">
                           <p>EF674521.1</p>
                        </c>
                        <c ca="center">
                           <p>exIV fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>283</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF VIa/b</p>
                        </c>
                        <c ca="center">
                           <p>EF689014.1; EF689015.1</p>
                        </c>
                        <c ca="center">
                           <p>exVIa/b fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>306</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF VIb-IXbd</p>
                        </c>
                        <c ca="center">
                           <p>EF689016.1</p>
                        </c>
                        <c ca="center">
                           <p>exVIb-IXbd fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>296</p>
                        </c>
                     </r>
                     <r>
                        <c ca="center">
                           <p>BDNF VIIa/b</p>
                        </c>
                        <c ca="center">
                           <p>EF689017.1; EF689018.1</p>
                        </c>
                        <c ca="center">
                           <p>exVII fwd/exIX rev1</p>
                        </c>
                        <c ca="center">
                           <p>285</p>
                        </c>
                     </r>
                  </tblbdy>
               </tbl>
            </sec>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>In order to characterize the effects of different antidepressants on total human BDNF mRNA expression, SH-SY5Y neuroblastoma cells were treated with FLX, RBX or DMI for 6 h (to assess the effects of short-term treatments), 24 or 48 hours, as in recent studies assessing the long-term effects of antidepressants in cultured cells <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. With regard to the antidepressant concentration in the cell medium, several studies have found that therapeutic plasma levels of these drugs in humans under chronic treatment are in the low micromolar range. However, it has been also shown that their concentrations in brain tissue can be as much as 20 times higher compared to plasma levels <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Moreover, it has been reported that brain concentrations of different antidepressants administered systemically at different doses were similar, without a clear correlation with either treatment dose or treatment duration <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Therefore, in order to expose the neuroblastoma cells to a drug concentration as close as possible to those reached in brain tissue, we chose to treat cultured SH-SY5Y cells with 10 &#956;M FLX, RBX or DMI in our experiments.</p>
         <p>Two-way ANOVA analysis of total BDNF mRNA expression showed significant effects of time (F<sub>3,193 </sub>= 25.04; p &lt; .0001), drug (F<sub>2,193 </sub>= 4.60; p &lt; .05) and interaction between the two variables (F<sub>6,193 </sub>= 4.48; p &lt; .001). In particular, RBX and DMI exerted a biphasic effect on BDNF mRNA: BDNF mRNA expression was reduced after 6 hours treatment with RBX or DMI, returned to basal level at 24 hours and was significantly increased after 48 hours (Fig. <figr fid="F2">2A</figr>). FLX did not show any significant effect at any time.</p>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Effects of antidepressant treatment on expression of total BDNF mRNA and BDNF transcripts in SH-SY5Y cells</p>
            </caption>
            <text>
               <p><b>Effects of antidepressant treatment on expression of total BDNF mRNA and BDNF transcripts in SH-SY5Y cells</b>. <b>A</b>. Expression of total BDNF mRNA in SH-SY5Y cells after 6 h, 24 h and 48 h treatment with 10 &#956;M fluoxetine (FLX), reboxetine (RBX) or desipramine (DMI), relative to untreated cells. Data are expressed as % intensity units/mm<sup>2 </sup>vs. untreated cells (mean &#177; s.e.m.). Statistics: two-way ANOVA, Bonferroni post-hoc test vs. untreated cells: *p &lt; 0,05 ***p &lt; 0,001 RBX vs. untreated cells; &#167;p &lt; 0,05 &#167;&#167;&#167;p &lt; 0,001 DMI vs. untreated cells. <b>B</b>. Expression level of BDNF IV transcript after 6 h and 48 h treatment with 10 &#956;M FLX, RBX or DMI, relative to untreated cells. *p &lt; 0.05 ***p &lt; 0.001 RBX vs. untreated cells; &#167;&#167;p &lt; 0.01 DMI vs. untreated cells. <b>C</b>. Expression level of BDNF VIa/b after treatment as in (B). Data and statistics as above. ***p &lt; 0.001 RBX vs. untreated cells.</p>
            </text>
            <graphic file="1471-2202-9-61-2"/>
         </fig>
         <p>The BDNF transcript expression pattern in SH-SY5Y cells is similar to that of human cortical tissue <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>: according to a recent nomenclature of BDNF gene <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>, BDNF IV and VI are the most highly expressed transcripts, representing over 80% of the total BDNF. Therefore, in order to evaluate if the modifications induced in total BDNF mRNA levels by antidepressants were due to alterations in the main BDNF transcripts, the expression profile of BDNF IV and VIa/b transcripts were analyzed. Cells were treated with FLX, DMI or RBX for 6 hours or 48 hours, times at which expression of total BDNF mRNA was changed after antidepressants (Fig. <figr fid="F2">2A</figr>), and BDNF transcript expression level was detected with semi-quantitative hemi-nested PCR. Two way ANOVA showed significant effects of time (F<sub>2,144 </sub>= 37,42; p &lt; .0001), drug (F<sub>2,144 </sub>= 23,39; p &lt; .0001) and time/drug interaction (F<sub>4,144 </sub>= 26,94; p &lt; .0001) for BDNF IV transcript: BDNF IV was significantly reduced after 6 hours and significantly increased after 48 h of RBX or DMI (Fig. <figr fid="F2">2B</figr>). FLX showed no effect. Two way ANOVA of BDNF VIa/b (Fig. <figr fid="F2">2C</figr>) showed a significant effect of time (F<sub>2,107 </sub>= 7,19; p &lt; .05) and of time/drug interaction (F<sub>4,107 </sub>= 7,53; p &lt; .0001). Post-hoc comparisons showed a significant reduction of BDNF VIa/b after 6 hours of RBX and no effects after 48 hours (Fig. <figr fid="F2">2C</figr>). In addition, we analyzed the expression of the low-level BDNF transcripts, BDNF I, II, VIb-IXbd and VIIa/b; all drug treatments did not change the expression of the transcripts (data not shown). BDNF III was undetectable; expression of exons V, Vh, VIII and VIIIh was not measured because, when the present work was completed, the new nomenclature was not yet published <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>To the best of our knowledge, this is the first study analyzing the effect of antidepressant treatments on the expression of BDNF transcripts in cells of human origin. Previous studies found time-dependent biphasic changes in the expression of total BDNF induced by antidepressants in rat brain <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. Similarly, we found that in SH-SY5Y cells RBX and DMI induced biphasic changes in total BDNF mRNA expression. Indeed, short-term treatment with both antidepressants significantly reduced, whereas long-term treatment increased total BDNF mRNA. At the intermediate time BDNF mRNA levels were similar to control. FLX did not significantly affect BDNF expression, likely owing to the absence of the serotonin transporter in SH-SY5Y cells, which instead express the norepinephrine transporter <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp>, and the 5-HT<sub>2b </sub>serotonergic receptor and the &#945;<sub>2c </sub>adrenoreceptor <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. Indeed, we could confirm the absence of any signal for serotonin transporter mRNA in SH-SY5Y cells by PCR (not shown). An alternative explanation could be found in the lack of changes in BDNF expression after fluoxetine treatment in rodents, as reported by several studies <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>.</p>
         <p>The present results suggest that early reduction of total BDNF mRNA in SH-SY5Y cells was mainly accounted for by a reduction of BDNF IV by RBX and DMI administration, and of BDNF VIa/b by RBX. On the other hand, the increase in total BDNF mRNA after 48 hours of treatment appeared to be mainly accounted for by the induction of BDNF IV by both drugs.</p>
         <p>Interestingly, previous studies in rodents have shown a differential regulation of distinct BDNF transcripts by antidepressant treatments <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr></abbrgrp>. In particular, it has been shown that chronic defeat stress, a model of depression, selectively down-regulated in mouse hippocampus the expression of BDNF III and BDNF IV transcripts (corresponding in the present study to BDNF IV and BDNF VIa/b respectively, according to the new nomenclature of BDNF gene), while chronic imipramine treatment reversed this down-regulation <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>The underlying molecular mechanisms are at present unknown; however, recent evidence from several groups suggest that different signaling mechanisms may be responsible for the regulation of BDNF transcription <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. As an example, it has been shown that different BDNF promoters contain multiple sites for various transcription factors (i.e. CREB, CaRF), responding to different signaling pathways mainly activated by calcium fluxes (CaM kinase cascades), by cyclic AMP (cAMP-PKA cascade) and by neurotrophic factors (MAP-Erk pathway). In this regard, we have recently reported that chronic administration of different antidepressants in rats exerts distinct actions on CREB activation that seem to depend on a differential modulation of CaM kinase IV and MAPK-Erk1/2 cascades <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Furthermore, we found that the CaM kinase IV cascade is also involved in the regulation of CREB activation by the mood stabilizer lithium <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>.</p>
         <p>Overall, although further studies are needed to clarify the upstream mechanisms, these results suggest that time-dependent biphasic changes in the expression of BDNF IV and VIa/b account for the observed changes induced by antidepressants in total BDNF mRNA of SH-SY5Y cells. Validation by quantitative Real-Time PCR is warranted. A limitation of the present work is that BDNF protein was not measured; because often mRNA and protein expression do not correlate, measurement of BDNF protein in SH-SY5Y after antidepressant treatments is warranted. Also considering recent reports on the different structure and regulation between rodent and human BDNF gene <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B13">13</abbr></abbrgrp>, SH-SY5Y cells could provide a useful tool to screen the effects of different psychotropics on human BDNF. Furthermore, it will be interesting to investigate whether similar effects are also found in peripheral cells of patients treated with antidepressants. In this regard, it is noteworthy that changes in serum concentrations of BDNF after antidepressant treatments have been measured in a number of works (as an example, see ref <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>).</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The present findings show biphasic changes in the expression of total and specific BDNF transcripts following antidepressant treatments in human cells and encourage the use of SH-SY5Y cells as a tool for research of psychotropic drug effects on human genes.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>LD carried out the molecular biology work. ET carried out the molecular biology work. DT performed the statistical analysis, and drafted the manuscript. LM performed the statistical analysis, and drafted the manuscript. GR help to draft the manuscript and provided useful discussion. MP designed the study, and drafted the manuscript. All authors contributed to and have approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>LD, DT, GR and MP were founded by a grant from Ministry of University, PRIN # 2005054953 (Italy).</p>
            <p>ET was founded by the PhD Program in Clinical Physiology and Pharmacology and Therapy of Metabolic Diseases, University of Milano, Medical School (Italy).</p>
            <p>LM was founded by the PhD Program in Pharmacotoxicological and Pharmacognostic Sciences and Pharmacological Biotechnologies, University of Milano (Italy).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Stress, depression, and neuroplasticity: a convergence of mechanisms</p>
            </title>
            <aug>
               <au>
                  <snm>Pittenger</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Duman</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>Neuropsychopharmacol</source>
            <pubdate>2008</pubdate>
            <volume>33</volume>
            <fpage>88</fpage>
            <lpage>109</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/sj.npp.1301574</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Signaling pathways regulating gene expression, neuroplasticity, and neurotrophic mechanisms in the action of antidepressants: a critical overview</p>
            </title>
            <aug>
               <au>
                  <snm>Tardito</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Perez</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tiraboschi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Musazzi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Racagni</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Popoli</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Pharmacol Rev</source>
            <pubdate>2006</pubdate>
            <volume>58</volume>
            <fpage>115</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1124/pr.58.1.7</pubid>
                  <pubid idtype="pmpid" link="fulltext">16507885</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Brain-derived neurotrophic factor and its receptor tropomyosin-related kinase B in the mechanism of action of antidepressant therapies</p>
            </title>
            <aug>
               <au>
                  <snm>Kozisek</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Middlemas</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bylund</snm>
                  <fnm>DB</fnm>
               </au>
            </aug>
            <source>Pharmacol Ther</source>
            <pubdate>2008</pubdate>
            <volume>117</volume>
            <fpage>30</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.pharmthera.2007.07.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">17949819</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Bi-phasic change in BDNF gene expression following antidepressant drug treatment</p>
            </title>
            <aug>
               <au>
                  <snm>Coppell</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Pei</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Zetterstr&#246;m</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Neuropharmacol</source>
            <pubdate>2003</pubdate>
            <volume>44</volume>
            <fpage>903</fpage>
            <lpage>910</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0028-3908(03)00077-7</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Fluoxetine-induced change in rat brain expression of brain-derived neurotrophic factor varies depending on length of treatment</p>
            </title>
            <aug>
               <au>
                  <snm>De Foubert</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Carney</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Robinson</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Destexhe</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Tomlinson</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hicks</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Murray</snm>
                  <fnm>TK</fnm>
               </au>
               <au>
                  <snm>Gaillard</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Deville</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Xhenseval</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>O'Neill</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Zetterstrom</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Neuroscience</source>
            <pubdate>2004</pubdate>
            <volume>128</volume>
            <fpage>597</fpage>
            <lpage>604</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.neuroscience.2004.06.054</pubid>
                  <pubid idtype="pmpid" link="fulltext">15381288</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Biphasic change in BDNF gene expression following antidepressant drug treatment explained by differential transcript regulation</p>
            </title>
            <aug>
               <au>
                  <snm>Khundakar</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Zetterstr&#246;m</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Brain Res</source>
            <pubdate>2006</pubdate>
            <volume>1106</volume>
            <fpage>12</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.brainres.2006.05.063</pubid>
                  <pubid idtype="pmpid" link="fulltext">16842762</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Mouse and rat BDNF gene structure and expression revisited</p>
            </title>
            <aug>
               <au>
                  <snm>Aid</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kazantseva</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Piirsoo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Palm</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Timmusk</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Neurosci Res</source>
            <pubdate>2007</pubdate>
            <volume>85</volume>
            <fpage>525</fpage>
            <lpage>535</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1878509</pubid>
                  <pubid idtype="pmpid" link="fulltext">17149751</pubid>
                  <pubid idtype="doi">10.1002/jnr.21139</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Rodent BDNF genes, novel promoters, novel splice variants, and regulation by cocaine</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>QR</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>XG</fnm>
               </au>
               <au>
                  <snm>Gong</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Shaham</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Uhl</snm>
                  <fnm>GR</fnm>
               </au>
            </aug>
            <source>Brain Res</source>
            <pubdate>2006</pubdate>
            <volume>1067</volume>
            <fpage>1</fpage>
            <lpage>12</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.brainres.2005.10.004</pubid>
                  <pubid idtype="pmpid" link="fulltext">16376315</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Differential regulation of brain derived neurotrophic factor transcripts by antidepressant treatments in the adult rat brain</p>
            </title>
            <aug>
               <au>
                  <snm>Dias</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Banerjee</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Duman</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Vaidya</snm>
                  <fnm>VA</fnm>
               </au>
            </aug>
            <source>Neuropharmacol</source>
            <pubdate>2003</pubdate>
            <volume>45</volume>
            <fpage>553</fpage>
            <lpage>563</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0028-3908(03)00198-9</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Stressor-Specific Regulation of Distinct Brain-Derived Neurotrophic Factor Transcripts and Cyclic AMP Response Element-Binding Protein Expression in the Postnatal and Adult Rat Hippocampus</p>
            </title>
            <aug>
               <au>
                  <snm>Nair</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Vadodaria</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Banerjee</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Benekareddy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dias</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Duman</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Vaidya</snm>
                  <fnm>VA</fnm>
               </au>
            </aug>
            <source>Neuropsychopharmacol</source>
            <pubdate>2007</pubdate>
            <volume>32</volume>
            <fpage>1504</fpage>
            <lpage>1519</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/sj.npp.1301276</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Hippocampal brain-derived neurotrophic factor expression following treatment with reboxetine, citalopram, and physical exercise</p>
            </title>
            <aug>
               <au>
                  <snm>Russo-Neustadt</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Alejandre</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Garcia</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ivy</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Neuropsychopharmacol</source>
            <pubdate>2004</pubdate>
            <volume>29</volume>
            <fpage>2189</fpage>
            <lpage>2199</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/sj.npp.1300514</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Sustained hippocampal chromatin regulation in a mouse model of depression and antidepressant action</p>
            </title>
            <aug>
               <au>
                  <snm>Tsankova</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Berton</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Renthal</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Kumar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Neve</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Nestler</snm>
                  <fnm>EJ</fnm>
               </au>
            </aug>
            <source>Nat Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>9</volume>
            <fpage>519</fpage>
            <lpage>525</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nn1659</pubid>
                  <pubid idtype="pmpid" link="fulltext">16501568</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Dissecting the human BDNF locus: Bidirectional transcription, complex splicing, and multiple promoters</p>
            </title>
            <aug>
               <au>
                  <snm>Pruunsild</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kazantseva</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Aid</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Palm</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Timmusk</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>2007</pubdate>
            <volume>90</volume>
            <fpage>397</fpage>
            <lpage>406</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ygeno.2007.05.004</pubid>
                  <pubid idtype="pmpid" link="fulltext">17629449</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes</p>
            </title>
            <aug>
               <au>
                  <snm>Vandesompele</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>De Preter</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pattyn</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Poppe</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Van Roy</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>De Paepe</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Speleman</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <fpage>RESEARCH0034</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">126239</pubid>
                  <pubid idtype="pmpid" link="fulltext">12184808</pubid>
                  <pubid idtype="doi">10.1186/gb-2002-3-7-research0034</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Improved detection of Mycobacterium tuberculosis in Peruvian children by use of a heminested IS6110 polymerase chain reaction assay</p>
            </title>
            <aug>
               <au>
                  <snm>Montenegro</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Gilman</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Sheen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cama</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Caviedes</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hopper</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chambers</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Oberhelman</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2003</pubdate>
            <volume>36</volume>
            <fpage>16</fpage>
            <lpage>23</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/344900</pubid>
                  <pubid idtype="pmpid" link="fulltext">12491196</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Fluoxetine up-regulates expression of cellular FLICE-inhibitory protein and inhibits LPS-induced apoptosis in hippocampus-derived neural stem cell</p>
            </title>
            <aug>
               <au>
                  <snm>Chiou</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Peng</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Ku</snm>
                  <fnm>HH</fnm>
               </au>
               <au>
                  <snm>Hsu</snm>
                  <fnm>WM</fnm>
               </au>
               <au>
                  <snm>Ho</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>CH</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2006</pubdate>
            <volume>343</volume>
            <fpage>391</fpage>
            <lpage>400</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2006.02.180</pubid>
                  <pubid idtype="pmpid" link="fulltext">16545775</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Proteomic analysis of rat cortical neurons after fluoxetine treatment</p>
            </title>
            <aug>
               <au>
                  <snm>Cecconi</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mion</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Astner</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Domenici</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Righetti</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Carboni</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Brain Res</source>
            <pubdate>2007</pubdate>
            <volume>1135</volume>
            <fpage>41</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.brainres.2006.12.008</pubid>
                  <pubid idtype="pmpid" link="fulltext">17196950</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Human brain fluoxetine concentrations</p>
            </title>
            <aug>
               <au>
                  <snm>Karson</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Newton</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Livingston</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Jolly</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Sprigg</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Komoroski</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>J Neuropsychiatry Clin Neurosci</source>
            <pubdate>1993</pubdate>
            <volume>5</volume>
            <fpage>322</fpage>
            <lpage>329</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8369643</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Brain pharmacokinetics and tissue distribution in vivo of fluvoxamine and fluoxetine by fluorine magnetic resonance spectroscopy</p>
            </title>
            <aug>
               <au>
                  <snm>Bolo</snm>
                  <fnm>NR</fnm>
               </au>
               <au>
                  <snm>Hod&#233;</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>N&#232;d&#232;lec</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Lain&#232;</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Macher</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Neuropsychopharmacol</source>
            <pubdate>2000</pubdate>
            <volume>23</volume>
            <fpage>428</fpage>
            <lpage>438</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0893-133X(00)00116-0</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Oligomeric amyloid decreases basal levels of brain-derived neurotrophic factor (BDNF) mRNA via specific downregulation of BDNF transcripts IV and V in differentiated human neuroblastoma cells</p>
            </title>
            <aug>
               <au>
                  <snm>Garzon</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Fahnestock</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2007</pubdate>
            <volume>27</volume>
            <fpage>2628</fpage>
            <lpage>2635</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.5053-06.2007</pubid>
                  <pubid idtype="pmpid" link="fulltext">17344400</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Effects of ischaemic conditions on uptake of glutamate, aspartate, and noradrenaline by cell lines derived from the human nervous system</p>
            </title>
            <aug>
               <au>
                  <snm>O'Neill</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Ball</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>PF</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>1994</pubdate>
            <volume>63</volume>
            <fpage>603</fpage>
            <lpage>611</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7913490</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of monoamine transporters in neuroblastoma cell lines: correlations to meta-iodobenzylguanidine (MIBG) uptake and tyrosine hydroxylase gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Lode</snm>
                  <fnm>HN</fnm>
               </au>
               <au>
                  <snm>Bruchelt</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Seitz</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gebhardt</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gekeler</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Niethammer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Eur J Cancer</source>
            <pubdate>1995</pubdate>
            <volume>31A</volume>
            <fpage>586</fpage>
            <lpage>590</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0959-8049(95)00039-L</pubid>
                  <pubid idtype="pmpid">7576974</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Identification of alpha 2-adrenergic receptor sites in human retinoblastoma (Y-79) and neuroblastoma (SH-SY5Y) cells</p>
            </title>
            <aug>
               <au>
                  <snm>Kazmi</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Mishra</snm>
                  <fnm>RK</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1989</pubdate>
            <volume>158</volume>
            <fpage>921</fpage>
            <lpage>928</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0006-291X(89)92810-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">2537639</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Functional alpha2C-adrenoceptors in human neuroblastoma SH-SY5Y cells</p>
            </title>
            <aug>
               <au>
                  <snm>Parsley</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gazi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bobirnac</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Loetscher</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Schoeffter</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Eur J Pharmacol</source>
            <pubdate>1999</pubdate>
            <volume>372</volume>
            <fpage>109</fpage>
            <lpage>115</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0014-2999(99)00190-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">10374721</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Cloning and functional characterization of the human 5-HT2B serotonin receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Schmuck</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ullmer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Engels</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>L&#252;bbert</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>1994</pubdate>
            <volume>342</volume>
            <fpage>85</fpage>
            <lpage>90</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0014-5793(94)80590-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">8143856</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Evidence for expression of the 5-hydroxytryptamine-2B receptor protein in the rat central nervous system</p>
            </title>
            <aug>
               <au>
                  <snm>Duxon</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Flanigan</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Reavley</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Baxter</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Blackburn</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Fone</snm>
                  <fnm>KC</fnm>
               </au>
            </aug>
            <source>Neuroscience</source>
            <pubdate>1997</pubdate>
            <volume>76</volume>
            <fpage>323</fpage>
            <lpage>329</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0306-4522(96)00480-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">9015317</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>cAMP response element-binding protein is essential for the upregulation of brain-derived neurotrophic factor transcription, but not the behavioral or endocrine responses to antidepressant drugs</p>
            </title>
            <aug>
               <au>
                  <snm>Conti</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Cryan</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Dalvi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lucki</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Blendy</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2002</pubdate>
            <volume>22</volume>
            <fpage>3262</fpage>
            <lpage>3268</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11943827</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Regulation of cAMP phosphodiesterase mRNAs expression in rat brain by acute and chronic fluoxetine treatment. An in situ hybridization study</p>
            </title>
            <aug>
               <au>
                  <snm>Mir&#243;</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>P&#233;rez-Torres</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Artigas</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Puigdom&#232;nech</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Palacios</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Mengod</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Neuropharmacol</source>
            <pubdate>2002</pubdate>
            <volume>43</volume>
            <fpage>1148</fpage>
            <lpage>1157</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0028-3908(02)00220-4</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Expression analysis of brain-derived neurotrophic factor (BDNF) mRNA isoforms after chronic and acute antidepressant treatment</p>
            </title>
            <aug>
               <au>
                  <snm>Altieri</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marini</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Arban</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Vitulli</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Jansson</snm>
                  <fnm>BO</fnm>
               </au>
            </aug>
            <source>Brain Res</source>
            <pubdate>2004</pubdate>
            <volume>1000</volume>
            <fpage>148</fpage>
            <lpage>155</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.brainres.2003.12.028</pubid>
                  <pubid idtype="pmpid" link="fulltext">15053962</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Temporal expression of brain-derived neurotrophic factor (BDNF) mRNA in the rat hippocampus after treatment with selective and mixed monoaminergic antidepressants</p>
            </title>
            <aug>
               <au>
                  <snm>Larsen</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Hay-Schmidt</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>R&#248;nn</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Mikkelsen</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Eur J Pharmacol</source>
            <pubdate>2008</pubdate>
            <volume>578</volume>
            <fpage>114</fpage>
            <lpage>122</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ejphar.2007.08.050</pubid>
                  <pubid idtype="pmpid" link="fulltext">17950272</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Selective phosphorylation of nuclear CREB by fluoxetine is linked to activation of CaM kinase IV and MAP kinase cascades</p>
            </title>
            <aug>
               <au>
                  <snm>Tiraboschi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tardito</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kasahara</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Moraschi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pruneri</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gennarelli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Racagni</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Popoli</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Neuropsychopharmacol</source>
            <pubdate>2004</pubdate>
            <volume>29</volume>
            <fpage>1831</fpage>
            <lpage>1840</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/sj.npp.1300488</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Reduced CREB phosphorylation after chronic lithium treatment is associated o downregulation of CaM kinase IV in rat hippocampus</p>
            </title>
            <aug>
               <au>
                  <snm>Tardito</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Tiraboschi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kasahara</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Racagni</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Popoli</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Int. J Neuropsychopharmacol</source>
            <pubdate>2007</pubdate>
            <volume>10</volume>
            <fpage>491</fpage>
            <lpage>496</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1017/S1461145706007140</pubid>
                  <pubid idtype="pmpid" link="fulltext">16923323</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Serum concentrations of nerve growth factor and brain-derived neurotrophic factor in depressed patients before and after antidepressant treatment</p>
            </title>
            <aug>
               <au>
                  <snm>Hellweg</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ziegenhorn</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Heuser</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Deuschle</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Pharmacopsychiatry</source>
            <pubdate>2008</pubdate>
            <volume>41</volume>
            <fpage>66</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1055/s-2007-1004594</pubid>
                  <pubid idtype="pmpid" link="fulltext">18311687</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
