<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2199-9-101</ui>
   <ji>1471-2199</ji>
   <fm>
      <dochead>Methodology article</dochead>
      <bibl>
         <title>
            <p>Construction of non-polar mutants in <it>Haemophilus influenzae </it>using FLP recombinase technology</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Tracy</snm>
               <fnm>Erin</fnm>
               <insr iid="I1"/>
               <email>Erin.Tracy@nationwidechildrens.org</email>
            </au>
            <au id="A2">
               <snm>Ye</snm>
               <fnm>Fang</fnm>
               <insr iid="I1"/>
               <email>Fang.Ye@nationwidechildrens.org</email>
            </au>
            <au id="A3">
               <snm>Baker</snm>
               <mi>D</mi>
               <fnm>Beth</fnm>
               <insr iid="I1"/>
               <email>Beth.Baker@nationwidechildrens.org</email>
            </au>
            <au ca="yes" id="A4">
               <snm>Munson</snm>
               <mi>S</mi>
               <fnm>Robert</fnm>
               <suf>Jr</suf>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>Munson.10@osu.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Center for Microbial Pathogenesis in The Research Institute at Nationwide Children's Hospital, Columbus, OH, USA</p>
            </ins>
            <ins id="I2">
               <p>The Center for Microbial Interface Biology and Department of Pediatrics, The Ohio State University, Columbus, OH, USA</p>
            </ins>
         </insg>
         <source>BMC Molecular Biology</source>
         <issn>1471-2199</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>101</fpage>
         <url>http://www.biomedcentral.com/1471-2199/9/101</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19014437</pubid>
               <pubid idtype="doi">10.1186/1471-2199-9-101</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>30</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>11</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>11</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Tracy et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Nontypeable <it>Haemophilus influenzae </it>(NTHi) is a gram-negative bacterium that causes otitis media in children as well as other infections of the upper and lower respiratory tract in children and adults. We are employing genetic strategies to identify and characterize virulence determinants in NTHi. NTHi is naturally competent for transformation and thus construction of most mutants by common methodologies is relatively straightforward. However, new methodology was required in order to construct unmarked non-polar mutations in poorly expressed genes whose products are required for transformation. We have adapted the lambda red/FLP-recombinase-mediated strategy used in <it>E. coli </it>for use in NTHi.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>A cassette containing a spectinomycin resistance gene and an <it>rpsL </it>gene flanked by FRT sites was constructed. A PCR amplicon containing 50 base pairs of DNA homologous to the 5' and 3' ends of the gene to be disrupted and the cassette was generated, then recombineered into the target NTHi gene, cloned on a plasmid, using the lambda recombination proteins expressed in <it>E. coli </it>DY380. Thus, the gene of interest was replaced by the cassette. The construct was then transformed into a streptomycin resistant NTHi strain and mutants were selected on spectinomycin-containing growth media. A plasmid derived from pLS88 with a temperature sensitive replicon expressing the FLP recombinase gene under the control of the <it>tet </it>operator/repressor was constructed. This plasmid was electroporated into the NTHi mutant at the permissive temperature and FLP expression was induced using anhydrotetracycline. The recombinase recognizes the FRT sites and eliminates the antibiotic cassette by site-specific recombination, creating the unmarked non-polar mutation. The plasmid is cured by growth of cells at the restrictive temperature.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The products of the genes in the NTHi <it>pilABCD </it>operon are required for type IV pilus biogenesis and have a role in transformation. We demonstrated the utility of our methodology by the construction of a non-polar <it>pilA </it>mutation in NTHi strain 2019 and complementation of the mutation with a plasmid containing the <it>pilA </it>gene. Utilization of this approach allowed us to readily generate unmarked non-polar mutations in NTHi genes.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification id="endnote" subtype="user_supplied_xml" type="bmc"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Nontypeable <it>Haemophilus influenzae </it>(NTHi) is a gram-negative bacterium, which is a major cause of otitis media <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. The organism also causes pneumonia and other respiratory tract diseases in humans <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. Type IV pili (Tfp) mediate adherence, twitching motility, and play a role in transformation (reviewed by Craig et al <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>). We previously demonstrated that NTHi produce Tfp under defined environmental conditions. These Tfp are responsible for twitching motility, Tfp-mediated adherence and contribute to biofilm development <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. The products of the <it>pilABCD </it>gene cluster play a role in Tfp biogenesis <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. The <it>pilA </it>gene is predicted to encode the major pilin subunit. The PilB protein is homologous to hexameric secretion ATPases and the PilC protein has homology to inner membrane proteins required for Tfp pilus assembly in other organisms. PilD is predicted to be the prepilin peptidase. These genes are in an operon, which necessitates the construction of non-polar mutants in order to carefully define the role of each gene product.</p>
         <p>In NTHi, non-polar mutants have been constructed using the non-polar kanamycin resistance cassette designed by Menard et al <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, see for example Mason et al <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. This kanamycin resistance gene is promoter-less; thus, transcription is driven from the promoter of the operon. The level of transcription must therefore be at a level sufficient to confer a kanamycin-resistant phenotype to the mutant under normal growth conditions. Alternatively, a non-polar mutant can be constructed in two steps. First, a mutant is constructed using standard methodologies <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> in which a gene has been interrupted with a cassette containing both a selectable and counter-selectable marker. Then, DNA containing an in-frame deletion of the gene of interest together with flanking chromosomal DNA 5' and 3' of the deleted gene is transformed into the mutant. Mutants containing the in-frame deletion are isolated by selection against the counter-selectable marker. Neither of these methodologies is suitable for use with genes whose products are required for transformation since the genes are poorly expressed under normal growth conditions and mutants deficient in the expression of these genes cannot be transformed. We thus adapted the methodologies employed by Wanner and coworkers <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp> to construct non-polar mutations in NTHi.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Construction of a non-polar mutant in the NTHi <it>pilA </it>gene</p>
            </st>
            <p>Mutations have been engineered into the <it>E. coli </it>chromosome using the lambda phage recombinase to catalyze the site-specific insertion of a PCR amplicon containing 50 bp homology arms and a cassette flanked by FRT (FLP <ul>r</ul>ecombinase <ul>t</ul>arget) sites, replacing the gene of interest <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Given the restriction barriers present in NTHi strains, it was necessary to perform the insertional inactivation of the NTHi genes of interest by cloning the gene together with flanking sequences onto a plasmid, then insertionally inactivating the gene in <it>E. coli </it>before moving the mutation into NTHi using the natural transformation system <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. <it>E. coli </it>strain DY380 has previously been used for engineering plasmids using the products of the phage lambda recombinase genes <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. This strain is lysogenized with a defective lambda phage that expresses the recombinase genes under the control of the temperature sensitive &#955;<it>cI</it>857 repressor and thus is a suitable host for recombineering <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. In order to construct a <it>pilA </it>mutation in NTHi, the <it>pil </it>gene cluster was first amplified from NTHi strain 2019, then cloned into pGEM-T Easy and transformed into <it>E. coli </it>strain DY380 to form strain DY380(pRSM2855).</p>
            <p>The plasmid pKD13 contains the kanamycin resistance gene from Tn5 flanked by FRT sites recognized by the FLP recombinase <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. We modified pKD13 so that it contained a spectinomycin resistance gene; in NTHi, spectinomycin provides a strong selectable marker with little background. The normal allele of an <it>rpsL </it>gene from <it>Neisseria gonorrhoeae </it>(designated <it>rpsL</it><sub>Ng</sub>) was also added to the construct to provide a counter selectable marker <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. This plasmid was designated pRSM2832. Employing pRSM2832 as a template, a PCR amplicon was generated using the strategy of Baba et al <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. The 5' primer was designed to include 50 nt 5' to and including the ATG start codon of the <it>pilA </it>gene. The 3' primer was designed to contain the complement of the last 21 nt including the stop codon of the <it>pilA </it>gene. Both primers contained regions homologous to the cassette containing the spectinomycin resistance gene and the <it>rpsL</it><sub>Ng </sub>gene (Figure <figr fid="F1">1</figr>). The amplicon (Figure <figr fid="F2">2A</figr>) was electroporated into <it>E. coli </it>strain DY380(pRSM2855) after heat shock and spectinomycin-resistant clones were isolated. A plasmid containing the anticipated insertion/deletion mutation in the <it>pilA </it>gene was saved as pRSM2857 (Figure <figr fid="F2">2C</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Generation of a PCR amplicon for insertion/deletion mutagenesis of the <it>pilA </it>gene</p>
               </caption>
               <text>
                  <p><b>Generation of a PCR amplicon for insertion/deletion mutagenesis of the <it>pilA </it>gene</b>. In Panel A, the <it>pilA </it>gene from NTHi strain 2019 is shown. Homology arm 1 (H1) contains 50 base pairs of DNA 5' to and including the ATG start codon of <it>pilA</it>. Homology arm 2 (H2) contains the complement of the last 21 base pairs of the <it>pilA </it>gene and 29 base pairs immediately downstream of the <it>pilA </it>gene. In Panel B, the template region of pRSM2832 is shown. Primer H1P1 contains the sequence from H1 and 20 base pairs of DNA homologous to the 5' end of the cassette (P1). Primer H2P2 contains the sequence from H2 and 20 base pairs of DNA homologous to the 3' end of the cassette. PCR amplification of pRSM2832 with primers H1P1 and H2P2 (primers 5 and 6) yielded the product shown in Panel C.</p>
               </text>
               <graphic file="1471-2199-9-101-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Construction of a non-polar <it>pilA </it>mutant</p>
               </caption>
               <text>
                  <p><b>Construction of a non-polar <it>pilA </it>mutant</b>. The PCR amplicon from Figure 1 is shown in Panel A. The cloned <it>pilABCD </it>region of pRSM2855 is shown in Panel B. The amplicon was electroporated into <it>E. coli </it>DY380(pRSM2855) and the lambda recombinase genes were induced by temperature shock. Spectinomycin-resistant clones were selected. The insert region of plasmid pRSM2857 is shown in Panel C. Plasmid pRSM2857 was linearized and transformed into NTHi strain 2019 <it>rpsL</it>; spectinomycin-resistant clones were isolated. NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA</it>::spec-<it>rpsL</it><sub>Ng </sub>was saved, then transformed with pRSM2947 at the permissive temperature; kanamycin resistant clones were isolated. Expression of the FLP recombinase resulted in the loss of the spectinomycin resistance gene-<it>rpsL</it><sub>Ng </sub>cassette; growth at 37&#176;C resulted in the loss of the plasmid. The <it>pil </it>region of NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA </it>is depicted in Panel D.</p>
               </text>
               <graphic file="1471-2199-9-101-2"/>
            </fig>
            <p>NTHi strain 2019 is a well-characterized isolate from a patient with chronic bronchitis <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. The pRSM2857 insert was separated from the plasmid backbone by digestion with NcoI and NsiI, then transformed into a streptomycin-resistant derivative of NTHi strain 2019, designated NTHi strain 2019 <it>rpsL</it>, using the MIV methodology <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. A strain containing the anticipated insertion/deletion mutation in the <it>pilA </it>gene was saved as NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA</it>::spec-<it>rpsL</it><sub>Ng</sub>. The next step in the construction was the removal of the cassette, which is flanked by FRT sites, by expression of the FLP recombinase.</p>
            <p>We constructed a temperature sensitive derivative of pLS88, a plasmid that replicates in NTHi and cloned the FLP recombinase gene into this construct under control of the <it>tet </it>operator/repressor (Figure <figr fid="F3">3</figr>). This plasmid, designated pRSM2947, was electroporated into NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA</it>::spec-<it>rpsL</it><sub>Ng </sub>and kanamycin resistant clones were isolated. One clone was saved as NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA</it>::spec-<it>rpsL</it><sub>Ng </sub>(pRSM2947). Expression of the FLP recombinase was induced in this strain, then clones were isolated at 37&#176;C on streptomycin-containing medium. One streptomycin-resistant clone was saved as NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA </it>for further characterization. The <it>pil </it>region in the mutant is represented in Figure <figr fid="F2">2D</figr>.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Map of plasmid pRSM2947</p>
               </caption>
               <text>
                  <p><b>Map of plasmid pRSM2947</b>. The plasmid contains: the FLP recombinase gene under the control of the <it>tet </it>regulatory system; a temperature sensitive replicon suitable for use in NTHi; a ColE1 origin that is functional in <it>E. coli </it>and a kanamycin resistance marker.</p>
               </text>
               <graphic file="1471-2199-9-101-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>The NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA </it>mutant was not transformable; the phenotype was complemented by the <it>pilA </it>gene</p>
            </st>
            <p>The product of the genes in the <it>pil </it>gene cluster is required for transformation using the MIV methodology <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Transformability of the &#916;<it>pilA </it>mutant was tested using a modification of the MIV methodology <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. In order to generate a DNA substrate for transformation, we cloned, then insertionally inactivated, the <it>H. influenzae </it>strain Rd <it>cya </it>gene with a non-polar kanamycin cassette to form pRSM2948 (data not shown). Plasmids were digested with NotI. The linear DNA fragment containing the interrupted <it>cya </it>gene was transformed into the NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA </it>and strain 2019 <it>rpsL </it>using the modified MIV methodology. Transformants were selected on chocolate agar containing kanamycin. Transformation efficiency (number of transformants/&#956;g of DNA) is shown in Table <tblr tid="T1">1</tblr>. Approximately 5 &#215; 10<sup>5 </sup>transformants/&#956;g of DNA was obtained with strain 2019 <it>rpsL</it>, while transformants were not detected with the mutant under these conditions. We cloned the <it>pilA </it>gene into a shuttle vector forming pRSM2848 and electroporated the construct into NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA</it>. We then tested the transformability of the complemented strain using the interrupted <it>cya </it>gene as described above. Approximately 1.5 &#215; 10<sup>5 </sup>transformants/&#956;g of DNA was obtained with the complemented strain (Table <tblr tid="T1">1</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Transformation of strain 2019 derivatives</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center" cspan="4">
                        <p>
                           <b>Number of transformants/&#956;g of DNA</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center" cspan="4">
                        <p>
                           <b>Strains</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2019 <it>rpsL</it></p>
                     </c>
                     <c ca="center">
                        <p>2019 <it>rpsL</it>&#916;<it>pilA</it></p>
                     </c>
                     <c ca="center">
                        <p>2019 <it>rpsL</it>&#916;<it>pilA </it>(pRSM2848)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Experiment #1</p>
                     </c>
                     <c ca="center">
                        <p>5.4 &#215; 10<sup>5</sup></p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                     <c ca="center">
                        <p>1.3 &#215; 10<sup>5</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Experiment #2</p>
                     </c>
                     <c ca="center">
                        <p>4.8 &#215; 10<sup>5</sup></p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                     <c ca="center">
                        <p>1.7 &#215; 10<sup>5</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center" cspan="4">
                        <p>
                           <b>Strains</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2019</p>
                     </c>
                     <c ca="center">
                        <p>2019 <it>pilA</it>::&#937;Km2</p>
                     </c>
                     <c ca="center">
                        <p>2019 <it>pilA</it>::&#937;Km2 (pRSM2848)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Experiment #3</p>
                     </c>
                     <c ca="center">
                        <p>3.9 &#215; 10<sup>3</sup></p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Experiment #4</p>
                     </c>
                     <c ca="center">
                        <p>5.6 &#215; 10<sup>3</sup></p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>ND is not detected.</p>
               </tblfn>
            </tbl>
            <p>Although the putative functions of the <it>pilB</it>, <it>pilC </it>and <it>pilD </it>genes make it likely that the products of these genes are required for transformation, we demonstrated that a polar mutation in the <it>pilA </it>gene could not be complemented with plasmid pRSM2848, the plasmid expressing the <it>pilA </it>gene. A polar <it>pilA </it>mutant, designated 2019 <it>pilA</it>::&#937;Km2, was constructed by insertion of the &#937;Km2 cassette into the <it>pilA </it>gene as described <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. As anticipated, this mutant is not transformable and the mutation could not be complemented with the cloned <it>pilA </it>gene (Table <tblr tid="T1">1</tblr>).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We have developed a new methodology for the construction of mutants in NTHi. This methodology was developed to overcome technical issues related to the construction of non-polar mutants in poorly expressed genes whose products are required for transformation. However, the method is straightforward and robust. We have successfully constructed over 20 mutants using this method and now construct all <it>H. influenzae </it>mutants in our laboratory using this method. The methodology should also be applicable to other naturally transformable members of the <it>Pasteurellaceae </it>family that support the replication of pLS88 derivatives.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Bacterial strains, plasmids and growth conditions</p>
            </st>
            <p>NTHi strain 2019 is a well characterized strain from a patient with chronic bronchitis <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. NTHi strain 2019 <it>rpsL </it>was constructed by Apicella and coworkers. This strain contains a mutation resulting in a K43R modification in RpsL; the strain is resistant to 1 mg of streptomycin/ml. Both strains were kindly provided by Dr. Michael Apicella. NTHi strains were grown on chocolate agar or in Brain Heart Infusion broth supplemented with 2 &#956;g of NAD/ml and 2 &#956;g of heme/ml (sBHI). Growth media were supplemented with spectinomycin, kanamycin, chloramphenicol or streptomycin at 200 &#956;g/ml, 20 &#956;g/ml, 1 &#956;g/ml or 1 mg/ml, respectively, when appropriate. <it>E. coli </it>strains were grown on LB broth or agar. Growth media were supplemented with spectinomycin, kanamycin, chloramphenicol or ampicillin at 50 &#956;g/ml, 20 &#956;g/ml, 30 &#956;g/ml or 50 ug/ml, respectively, when appropriate. Strain DY380 was grown at 32&#176;C. A complete list of strains and plasmids used in this study is provided [see Additional file <supplr sid="S1">1</supplr>].</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Bacterial strains and plasmids.</b> This table contains a complete list of strains and plasmids used in this study.</p>
               </text>
               <file name="1471-2199-9-101-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Construction of a template plasmid containing a cassette with a spectinomycin resistance gene and an <it>rpsL </it>gene flanked by FRT sites</p>
            </st>
            <p>The plasmid pKD13 has been used as a template plasmid for the construction of a complete set of <it>E. coli </it>strains with mutations in each non-essential gene <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. We modified this vector by replacing the kanamycin resistance gene with a spectinomycin resistance gene and the <it>rpsL</it><sub>Ng </sub>gene. The plasmid pSpecR <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> was digested with EcoRV and the EcoRV fragment containing the spectinomycin resistance gene was cloned into the EcoRV site of pWSK30 <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. A plasmid with the correct restriction map was saved as pRSM2790. The counter selectable marker, <it>rpsL</it><sub>Ng</sub>, was amplified by PCR using genomic DNA purified from <it>N. gonorrhoeae </it>strain FA1090 and primers 1 and 2 containing BamHI and NotI sites at the 5' end, respectively (Table <tblr tid="T2">2</tblr>). The amplicon was digested with NotI and BamHI, then cloned into the plasmid pRSM2790 that had been digested with these enzymes. A plasmid with the correct insert was identified and saved as pRSM2830. The kanamycin cassette from pKD13 was eliminated by PCR amplification of a portion of pKD13 using primers 3 and 4 which face outward from inside the FRT sites. The spectinomycin resistance gene-<it>rpsL</it><sub>Ng </sub>cassette was isolated from the pRSM2830 by digestion with SacI and XhoI and cloned into the pKD13-derived PCR product. Clones were selected on LB-agar containing spectinomycin. The plasmid from a spectinomycin-resistant clone was characterized by restriction digestion and sequencing, then saved as pRSM2832.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Oligonucleotide primers</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 1</p>
                     </c>
                     <c ca="left">
                        <p>GC<b>GGATCC</b>CCGACTGATTGTGAGGGATGTCGG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 2</p>
                     </c>
                     <c ca="left">
                        <p>GC<b>GCGGCCGC</b>CCGACTGATTGTGAGGGATGTCGG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 3</p>
                     </c>
                     <c ca="left">
                        <p>GC<b>GAGCTC</b>GCATCGCCTTCTATCGCCTTCTTG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 4</p>
                     </c>
                     <c ca="left">
                        <p>GC<b>CTCGAG</b>CAGCCCTTGCGCCCTGAGTG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 5</p>
                     </c>
                     <c ca="left">
                        <p>CTTTTCACAATGTTGTCGCTAACAAAGGCTTAATAAAAGGAAAATGAATGATTCCGGGGATCCGTCGACC</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 6</p>
                     </c>
                     <c ca="left">
                        <p>ACGCTGAGTATGAAGTAAAGCATAGCTCGTCATTTTGTGACACTTCTGCATGTAGGCTGGAGCTGCTTCG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 7</p>
                     </c>
                     <c ca="left">
                        <p>GCGCGTCGACAACCAATAAGGAAATA</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 8</p>
                     </c>
                     <c ca="left">
                        <p>CGAGGCAATGGATCAACAGAAG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 9</p>
                     </c>
                     <c ca="left">
                        <p>GGGCGTTTATCGAAGTGAGG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 10</p>
                     </c>
                     <c ca="left">
                        <p>TCAACCCCTAGCCAAAGAC</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 11</p>
                     </c>
                     <c ca="left">
                        <p>CGCGGATCCTGCCGCCTGTTTTTCCTGCTCATT</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 12</p>
                     </c>
                     <c ca="left">
                        <p>CTGTTATCCTTAAATCTCGCTTATTAGGTGTGCTTGTATTTCTTGGG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 13</p>
                     </c>
                     <c ca="left">
                        <p>CCCAAGAAATACAAGCACACCTAATAAGCGAGATTTAAGGATAACAG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 14</p>
                     </c>
                     <c ca="left">
                        <p>CGC<b>GGATCC</b>GCGGCCGCGTGACACGACGATGCTAAA</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 15</p>
                     </c>
                     <c ca="left">
                        <p>ATATAAT<b>GCGGCCGC</b>TACGGTTATCCACAGAATCA</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 16</p>
                     </c>
                     <c ca="left">
                        <p>ATATAAT<b>GCGGCCGC</b>CTCACTGATTAAGCATTGG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 17</p>
                     </c>
                     <c ca="left">
                        <p>CGC<b>GGATCC</b>CGATGGGTGGTTAACTCGAC</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 18</p>
                     </c>
                     <c ca="left">
                        <p>CGC<b>GGATCC</b>ACAGGACGGGTG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 19</p>
                     </c>
                     <c ca="left">
                        <p>GC<b>ACGCGT</b>TCGTCAAATATTACGGATATTAA</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>primer 20</p>
                     </c>
                     <c ca="left">
                        <p>GC<b>ACGCGT</b>TCATTGTGTGACACTTCCG</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Restriction endonuclease cleavage sites are shown in bold.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Amplification of the cassette</p>
            </st>
            <p>Since lambda recombinase requires less than 50 bp of homology for efficient recombination, PCR primers of approximately 70 nt in length were designed using the strategy of Baba et al <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. The 5' PCR primer (primer 5) had a 50 nt homology arm (H1) including the sequence upstream of <it>pilA </it>as well as the <it>pilA </it>start codon and the 20 nt sequence 5'-ATTCCGGGGATCCGTCGACC-3' (P1) which is complementary to sequence 5' of the spectinomycin resistance gene-<it>rpsL </it>cassette (Figure <figr fid="F1">1</figr>). The 3' primer (primer 6) contained the complement of the last 21 nt of the <it>pilA </it>gene including the termination codon and 29 nt downstream (H2) as well as the 20 nt sequence 5'-TGTAGGCTGGAGCTGCTTCG-3' (P2) which is complementary to sequence 3' of the spectinomycin resistance gene-<it>rpsL</it><sub>Ng </sub>cassette. A PCR amplicon was generated using these primers together with pRSM2832 as the template. Amplification was performed in a 50 &#956;l reaction containing 1 U Phusion High Fidelity DNA Polymerase (New England Biolabs), 25 ng pRSM2832 DNA, 0.4 &#956;M of each primer, and 200 &#956;M dNTPs under the following conditions: 98&#176;C for 30 seconds, 30 cycles of 98&#176;C for 10 seconds, 51&#176;C for 20 seconds, 72&#176;C for 3 minutes, and a final extension of 72&#176;C for 10 minutes. The amplicon thus contains the spectinomycin resistance gene-<it>rpsL </it>cassette flanked by the homology arms H1 and H2.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of a <it>pilA </it>mutant in NTHi strain 2019 <it>rpsL </it>containing the spectinomycin resistance gene-<it>rpsL</it><sub>Ng </sub>cassette</p>
            </st>
            <p>The <it>pilABCD </it>gene cluster of NTHi strain 2019 as well as 227 bp 5' of the <it>pilA </it>gene was amplified by PCR from genomic DNA purified from NTHi strain 2019 using primers 7 and 8 and cloned into pGEM-T Easy (Promega) (Figure <figr fid="F2">2B</figr>). The nucleotide sequence of the NTHi strain 2019 <it>pilABCD </it>gene cluster is 94% identical to the gene cluster in strain 86-028NP (Genbank Accession # <ext-link ext-link-id="CP000057" ext-link-type="gen">CP000057</ext-link>). Plasmid DNA was purified, verified by restriction digestion, and sequenced. A clone with the correct sequence was identified and saved as pRSM2855. Plasmid pRSM2855 was transformed into the <it>E. coli </it>strain DY380 at 32&#176;C and clones were selected on LB agar containing ampicillin. Strain DY380 contains a defective lambda prophage with a temperature sensitive repressor <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. In this strain, the lambda recombinase genes are actively transcribed after temperature shock at 42&#176;C.</p>
            <p>To construct a plasmid containing a marked deletion of the <it>pilA </it>gene, 200 ng of PCR product containing the spectinomycin resistance gene-<it>rpsL</it><sub>Ng </sub>cassette was electroporated into <it>E. coli </it>DY380(pRSM2855) that had been heat shocked at 42&#176;C for 15 minutes prior to preparation of electrocompetent cells as described by Lee et al <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Clones were then selected at 32&#176;C on LB agar containing spectinomycin. A plasmid containing a deletion of the <it>pilA </it>gene with an insertion of the cassette was identified and saved as pRSM2857 (Figure <figr fid="F2">2C</figr>).</p>
            <p>Plasmid pRSM2857 was digested with NcoI and NsiI to release the insert from the pGEM-T Easy vector backbone, then transformed into NTHi strain 2019 <it>rpsL </it>using the MIV methodology <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Clones were selected on chocolate agar supplemented with spectinomycin. Putative mutants were screened for streptomycin sensitivity on chocolate agar containing streptomycin. The genotype of presumptive mutants was further characterized by PCR amplification of the genomic region using primers 9 and 10, followed by sequencing.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of the FLP Recombinase containing plasmid, pRSM2947</p>
            </st>
            <p>Deletion of the cassette to generate the non-polar mutation in NTHi strain 2019 <it>rpsL </it>requires the activity of the FLP recombinase. We constructed a temperature sensitive plasmid containing the FLP recombinase gene under the control of the <it>tet </it>promoter/repressor system. Briggs and Tatum previously reported the construction of a plasmid with a temperature sensitive replicon suitable for use in members of the <it>Pasteurellaceae </it>family <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. This plasmid has the same replicon as the plasmid pLS88 <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. A point mutation of G to A at base 2196 of pLS88 was introduced into a fragment of pLS88 containing the replicon and kanamycin resistance gene using overlap PCR. Briefly, amplicons 1 and 2 corresponding to NT 1715 to 2220 and 2174 to 4093 of pLS88 were generated with primers 11 and 12 or primers 13 and 14, respectively, using pLS88 DNA as template. Amplicon 3 was generated with primers 11 and 14, which both contain BamHI sites, using amplicons 1 and 2 as template. The amplicon was digested with BamHI, and self-ligated. The ligation mixture was transformed into <it>H. influenzae </it>strain Rd by electroporation. Plasmid-containing strains were selected by growth at 32&#176;C on chocolate agar containing kanamycin. Strains containing the correct plasmid were identified by screening for growth at 32&#176;C, but absence of growth at 37&#176;C on chocolate agar containing kanamycin. A temperature sensitive plasmid was saved as pRSM2865. This intermediate plasmid is 2.3 Kb in size and contains unique NotI and BamHI sites. The presence of the mutation in pRSM2865 was confirmed by DNA sequencing. Although pLS88 is stably maintained in <it>E. coli</it>, pRSM2865 could not be maintained in <it>E. coli</it>, even when grown at 32&#176;C. Thus, for convenience, a fragment of pUC19 containing the ColE1 replicon was amplified with primers 15 and 16; both primers contain a NotI site. The resulting amplicon was digested with Not I, then cloned into NotI-digested pRSM2865. After transformation into <it>E. coli </it>strain DH5&#945;, a plasmid with the correct restriction map was saved as pRSM2866. Using pFT-A <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> as template and primers 17 and 18, which contain BamHI sites, an amplicon was generated which contained the FLP recombinase gene under control of the <it>tet </it>promoter/repressor system flanked by BamHI sites. The amplicon was digested with BamHI and the product ligated to BamHI-digested pRSM2866. The ligation mixture was transformed into DH5&#945; and clones selected on LB agar containing kanamycin. A plasmid with the correct restriction map was identified and saved as pRSM2947 (Figure <figr fid="F3">3</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Construction of <it>pilA </it>mutants in NTHi strain 2019 background</p>
            </st>
            <p>In order to construct an in-frame, non-polar deletion of the cloned <it>pilA </it>gene in NTHi strain 2019 <it>rpsL</it>, plasmid pRSM2947 was transformed by electroporation into NTHi strain 2019 <it>rpsL</it>&#916;<it>pilA</it>::spec-<it>rpsL</it><sub>Ng </sub>and transformants were selected at 32&#176;C on chocolate agar containing kanamycin. Clones were grown at 32&#176;C in sBHI broth supplemented with kanamycin until a final absorbance (600 nm) of 0.30 was reached. The FLP recombinase was then induced with 200 ng of anhydrotetracycline/ml for 2 hours, shaking (180 rpm) at 32&#176;C. Unmarked mutants were then selected by growth at 37&#176;C on chocolate agar supplemented with streptomycin. Mutants were then screened for loss of both spectinomycin and kanamycin resistance genes and the genotype was verified by PCR and sequencing (Figure <figr fid="F2">2D</figr>). Although convenient, the streptomycin counterselection is not necessary. After induction of the FLP recombinase using our methodology, the cassette is resolved in approximately 2% of the clones; thus, it is possible to identify mutants by screening. A detailed protocol for mutant construction in NTHi strains is provided [see Additional file <supplr sid="S2">2</supplr>].</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Protocol for construction of mutants in NTHi.</b> A detailed protocol is presented to aid investigators in the use of this technology.</p>
               </text>
               <file name="1471-2199-9-101-S2.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>A polar mutation in the <it>pilA </it>gene of strain 2019 was constructed as described <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. The mutant is designated 2019 <it>pilA</it>::&#937;Km2.</p>
         </sec>
         <sec>
            <st>
               <p>Complementation of the <it>pilA </it>mutation in NTHi strains 2019 <it>rpsL</it>&#916;<it>pilA </it>and 2019 <it>pilA</it>::&#937;Km2</p>
            </st>
            <p>The plasmid pPIL1 containing the NTHi <it>pilABCD </it>gene cluster <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> was PCR amplified with primers 19 and 20, which face outward from the 3' end of <it>pilA </it>and the 3'end of <it>pilD</it>. The primers both contain MluI sites on their 5' ends. The amplicon was digested with MluI, self-ligated, and transformed into <it>H. influenzae </it>strain Rd. The resulting plasmid contained the pSPEC1 backbone, the <it>pilA </it>gene, and a small ORF containing the 5' portion of the <it>pilB </it>gene cloned in-frame with the 3' end of the <it>pilD </it>gene. A clone with the correct restriction map was sequenced, then saved as pRSM2848. The plasmid pRSM2848 was then transformed into NTHi strains 2019 <it>rpsL</it>&#916;<it>pilA </it>and 2019 <it>pilA</it>::&#937;Km2.</p>
         </sec>
         <sec>
            <st>
               <p>Cloning and insertional inactivation of the <it>cya </it>gene</p>
            </st>
            <p>We cloned and insertionally inactivated the <it>cya </it>gene. This interrupted gene was used to test the strains for their ability to be transformed. The <it>cya </it>gene from <it>H</it>. <it>influenzae </it>strain Rd and approximately 1 Kb of flanking DNA 5' and 3' to the gene were amplified and cloned into pGEM-T Easy essentially as described for construction of pRSM2855. A clone with the correct restriction map was saved as pRSM2921. The non-polar kanamycin cassette <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> was cloned into KpnI- and BamHI-digested pRSM2921 as a KpnI to BamHI fragment. After ligation and transformation, a plasmid containing the insertionally inactivated <it>cya </it>gene was identified and saved as pRSM2948. The cloned <it>cya </it>gene was also insertionally inactivated by cloning a BamHI fragment containing the chloramphenicol cassette from pUC&#916;Ecat into BglII-digested pRSM2921. As plasmid containing the insertionally inactivated <it>cya </it>gene was saved as pRSM3004.</p>
         </sec>
         <sec>
            <st>
               <p>Determination of transformation efficiency</p>
            </st>
            <p>Transformation efficiency was determined in strains 2019 <it>rpsL</it>, 2019 <it>rpsL</it>&#916;<it>pilA </it>and 2019 <it>rpsL</it>&#916;<it>pilA</it>(pRSM2848). DNA from NotI-digested pRSM2948 was incubated with cells treated to induce competence using the modified MIV methodology; transformants were identified on chocolate agar plates containing kanamycin. Similarly, transformation efficiency was determined in strains 2019 <it>pilA</it>::&#937;Km2 and 2019 <it>pilA</it>::&#937;Km2(pRSM2848) using linearized pRSM3004 as above, except that transformants were selected on chloamphenicol-containing medium.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>ET and RSM designed the strategy and drafted the manuscript. FY constructed pRSM2947. BB cloned and insertionally inactivated the NTHi <it>cya </it>gene. ET was responsible for generation of the template plasmid, construction of the mutants and the transformation experiments. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by NIH grants R01DC007464 to RSM, R01DC003915 to Lauren Bakaletz and a subcontract from N01AI30040 to Michael Apicella. We thank Michael Apicella for the gifts of NTHi strains 2019 and 2019 <it>rpsL</it>.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Bacteriology of acute otitis media in a cohort of Finnish children followed for the first two years of life</p>
            </title>
            <aug>
               <au>
                  <snm>Kilpi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Herva</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kaijalainen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Syrjanen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Takala</snm>
                  <fnm>AK</fnm>
               </au>
            </aug>
            <source>Pediatr Infect Dis J</source>
            <pubdate>2001</pubdate>
            <volume>20</volume>
            <issue>7</issue>
            <fpage>654</fpage>
            <lpage>662</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00006454-200107000-00004</pubid>
                  <pubid idtype="pmpid" link="fulltext">11465836</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Respiratory infections caused by non-typeable <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Murphy</snm>
                  <fnm>TF</fnm>
               </au>
            </aug>
            <source>Curr Opin Infect Dis</source>
            <pubdate>2003</pubdate>
            <volume>16</volume>
            <issue>2</issue>
            <fpage>129</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12734445</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Type IV pilus structure and bacterial pathogenicity</p>
            </title>
            <aug>
               <au>
                  <snm>Craig</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pique</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Tainer</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Nat Rev Microbiol</source>
            <pubdate>2004</pubdate>
            <volume>2</volume>
            <issue>5</issue>
            <fpage>363</fpage>
            <lpage>378</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrmicro885</pubid>
                  <pubid idtype="pmpid" link="fulltext">15100690</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Demonstration of Type IV pilus expression and a twitching phenotype by <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Bakaletz</snm>
                  <fnm>LO</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>BD</fnm>
               </au>
               <au>
                  <snm>Jurcisek</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Harrison</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Novotny</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Bookwalter</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Mungur</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Munson</snm>
                  <fnm>RS</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2005</pubdate>
            <volume>73</volume>
            <issue>3</issue>
            <fpage>1635</fpage>
            <lpage>1643</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1064948</pubid>
                  <pubid idtype="pmpid" link="fulltext">15731063</pubid>
                  <pubid idtype="doi">10.1128/IAI.73.3.1635-1643.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Biofilms formed by nontypeable <it>Haemophilus influenzae </it>in vivo contain both double-stranded DNA and type IV pilin protein</p>
            </title>
            <aug>
               <au>
                  <snm>Jurcisek</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Bakaletz</snm>
                  <fnm>LO</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2007</pubdate>
            <volume>189</volume>
            <issue>10</issue>
            <fpage>3868</fpage>
            <lpage>3875</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1913342</pubid>
                  <pubid idtype="pmpid" link="fulltext">17322318</pubid>
                  <pubid idtype="doi">10.1128/JB.01935-06</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The PilA protein of non-typeable <it>Haemophilus influenzae </it>plays a role in biofilm formation, adherence to epithelial cells and colonization of the mammalian upper respiratory tract</p>
            </title>
            <aug>
               <au>
                  <snm>Jurcisek</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Bookwalter</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>BD</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Novotny</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Munson</snm>
                  <fnm>RS</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Bakaletz</snm>
                  <fnm>LO</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2007</pubdate>
            <volume>65</volume>
            <issue>5</issue>
            <fpage>1288</fpage>
            <lpage>1299</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2958.2007.05864.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17645732</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>A novel CRP-dependent regulon controls expression of competence genes in <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Redfield</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Cameron</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Qian</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Hinds</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ali</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Kroll</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Langford</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2005</pubdate>
            <volume>347</volume>
            <issue>4</issue>
            <fpage>735</fpage>
            <lpage>747</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jmb.2005.01.012</pubid>
                  <pubid idtype="pmpid" link="fulltext">15769466</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Characterization of three new competence-regulated operons in <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>VanWagoner</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Whitby</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Morton</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Seale</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Stull</snm>
                  <fnm>TL</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2004</pubdate>
            <volume>186</volume>
            <issue>19</issue>
            <fpage>6409</fpage>
            <lpage>6421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">516621</pubid>
                  <pubid idtype="pmpid" link="fulltext">15375121</pubid>
                  <pubid idtype="doi">10.1128/JB.186.19.6409-6421.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Nonpolar mutagenesis of the <it>ipa </it>genes defines IpaB, IpaC, and IpaD as effectors of <it>Shigella flexneri </it>entry into epithelial cells</p>
            </title>
            <aug>
               <au>
                  <snm>Menard</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sansonetti</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Parsot</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1993</pubdate>
            <volume>175</volume>
            <issue>18</issue>
            <fpage>5899</fpage>
            <lpage>5906</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">206670</pubid>
                  <pubid idtype="pmpid" link="fulltext">8376337</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>A mutation in the <it>sap </it>operon attenuates survival of nontypeable <it>Haemophilus influenzae </it>in a chinchilla model of otitis media</p>
            </title>
            <aug>
               <au>
                  <snm>Mason</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Munson</snm>
                  <fnm>RS</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Bakaletz</snm>
                  <fnm>LO</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2005</pubdate>
            <volume>73</volume>
            <issue>1</issue>
            <fpage>599</fpage>
            <lpage>608</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">538956</pubid>
                  <pubid idtype="pmpid" link="fulltext">15618200</pubid>
                  <pubid idtype="doi">10.1128/IAI.73.1.599-608.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Transformation of <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Poje</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Redfield</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Methods Mol Med</source>
            <pubdate>2003</pubdate>
            <volume>71</volume>
            <fpage>57</fpage>
            <lpage>70</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12374031</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Construction of <it>Escherichia coli </it>K-12 in-frame, single-gene knockout mutants: the Keio collection</p>
            </title>
            <aug>
               <au>
                  <snm>Baba</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Takai</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Okumura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Datsenko</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wanner</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Mori</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Mol Syst Biol</source>
            <pubdate>2006</pubdate>
            <volume>2</volume>
            <fpage>2006.0008</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid link="fulltext" idtype="pubmed">16738554</pubid>
                  <pubid idtype="pmpid" link="fulltext">16738554</pubid>
                  <pubid idtype="pmcid">1681482</pubid>
                  <pubid idtype="doi">10.1038/msb4100050</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>One-step inactivation of chromosomal genes in <it>Escherichia coli </it>K-12 using PCR products</p>
            </title>
            <aug>
               <au>
                  <snm>Datsenko</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Wanner</snm>
                  <fnm>BL</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2000</pubdate>
            <volume>97</volume>
            <issue>12</issue>
            <fpage>6640</fpage>
            <lpage>6645</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">18686</pubid>
                  <pubid idtype="pmpid" link="fulltext">10829079</pubid>
                  <pubid idtype="doi">10.1073/pnas.120163297</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>A highly efficient <it>Escherichia coli</it>-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Martinez de Velasco</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tessarollo</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Swing</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Court</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Copeland</snm>
                  <fnm>NG</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>2001</pubdate>
            <volume>73</volume>
            <issue>1</issue>
            <fpage>56</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/geno.2000.6451</pubid>
                  <pubid idtype="pmpid" link="fulltext">11352566</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Recombineering: a powerful new tool for mouse functional genomics</p>
            </title>
            <aug>
               <au>
                  <snm>Copeland</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Court</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Nat Rev Genet</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <issue>10</issue>
            <fpage>769</fpage>
            <lpage>779</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35093556</pubid>
                  <pubid idtype="pmpid" link="fulltext">11584293</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Construction of mutant strains of <it>Neisseria gonorrhoeae </it>lacking new antibiotic resistance markers using a two gene cassette with positive and negative selection</p>
            </title>
            <aug>
               <au>
                  <snm>Johnston</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>1999</pubdate>
            <volume>236</volume>
            <issue>1</issue>
            <fpage>179</fpage>
            <lpage>184</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1119(99)00238-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10433979</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Antigenic diversity of lipooligosaccharides of nontypable <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Campagnari</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Gupta</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Dudas</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Apicella</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1987</pubdate>
            <volume>55</volume>
            <issue>4</issue>
            <fpage>882</fpage>
            <lpage>887</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">260433</pubid>
                  <pubid idtype="pmpid" link="fulltext">3549563</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Regulation of sialic acid transport and catabolism in <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Johnston</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Zaleski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mootz</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Armbruster</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>BW</fnm>
               </au>
               <au>
                  <snm>Apicella</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Munson</snm>
                  <fnm>RS</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2007</pubdate>
            <volume>66</volume>
            <issue>1</issue>
            <fpage>26</fpage>
            <lpage>39</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2958.2007.05890.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17880422</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Role of sialic acid and complex carbohydrate biosynthesis in biofilm formation by nontypeable <it>Haemophilus influenzae </it>in the chinchilla middle ear</p>
            </title>
            <aug>
               <au>
                  <snm>Jurcisek</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Greiner</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zaleski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Apicella</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Bakaletz</snm>
                  <fnm>LO</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2005</pubdate>
            <volume>73</volume>
            <issue>6</issue>
            <fpage>3210</fpage>
            <lpage>3218</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1111813</pubid>
                  <pubid idtype="pmpid" link="fulltext">15908345</pubid>
                  <pubid idtype="doi">10.1128/IAI.73.6.3210-3218.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Construction of antibiotic resistance cassettes with multiple paired restriction sites for insertional mutagenesis of <it>Haemophilus influenzae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Whitby</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Morton</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Stull</snm>
                  <fnm>TL</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>1998</pubdate>
            <volume>158</volume>
            <issue>1</issue>
            <fpage>57</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1574-6968.1998.tb12800.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9453156</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in <it>Escherichia coli</it></p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Kushner</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>1991</pubdate>
            <volume>100</volume>
            <fpage>195</fpage>
            <lpage>199</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0378-1119(91)90366-J</pubid>
                  <pubid idtype="pmpid">2055470</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Generation and molecular characterization of new temperature-sensitive plasmids intended for genetic engineering of <it>Pasteurellaceae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Briggs</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Tatum</snm>
                  <fnm>FM</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>2005</pubdate>
            <volume>71</volume>
            <issue>11</issue>
            <fpage>7187</fpage>
            <lpage>7195</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1287723</pubid>
                  <pubid idtype="pmpid" link="fulltext">16269758</pubid>
                  <pubid idtype="doi">10.1128/AEM.71.11.7187-7195.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>An analysis of the complete nucleotide sequence of the <it>Haemophilus ducreyi </it>broad-host-range plasmid pLS88</p>
            </title>
            <aug>
               <au>
                  <snm>Dixon</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Albritton</snm>
                  <fnm>WL</fnm>
               </au>
               <au>
                  <snm>Willson</snm>
                  <fnm>PJ</fnm>
               </au>
            </aug>
            <source>Plasmid</source>
            <pubdate>1994</pubdate>
            <volume>32</volume>
            <issue>2</issue>
            <fpage>228</fpage>
            <lpage>232</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/plas.1994.1060</pubid>
                  <pubid idtype="pmpid" link="fulltext">7846148</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Versatile insertion plasmids for targeted genome manipulations in bacteria: isolation, deletion, and rescue of the pathogenicity island LEE of the <it>Escherichia coli </it>O157:H7 genome</p>
            </title>
            <aug>
               <au>
                  <snm>Posfai</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Koob</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Kirkpatrick</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Blattner</snm>
                  <fnm>FR</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1997</pubdate>
            <volume>179</volume>
            <issue>13</issue>
            <fpage>4426</fpage>
            <lpage>4428</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">179272</pubid>
                  <pubid idtype="pmpid" link="fulltext">9209066</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Use of electroporation to construct isogenic mutants of <it>Haemophilus ducreyi</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hansen</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Latimer</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Helminen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Albritton</snm>
                  <fnm>WL</fnm>
               </au>
               <au>
                  <snm>Radolf</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1992</pubdate>
            <volume>174</volume>
            <issue>16</issue>
            <fpage>5442</fpage>
            <lpage>5449</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">206384</pubid>
                  <pubid idtype="pmpid" link="fulltext">1644771</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Mry, a trans-acting positive regulator of the M protein gene of <it>Streptococcus pyogenes </it>with similarity to the receptor proteins of two-component regulatory systems</p>
            </title>
            <aug>
               <au>
                  <snm>Perez-Casal</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Caparon</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1991</pubdate>
            <volume>173</volume>
            <issue>8</issue>
            <fpage>2617</fpage>
            <lpage>2624</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">207828</pubid>
                  <pubid idtype="pmpid" link="fulltext">1849511</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
