<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2199-8-34</ui>
   <ji>1471-2199</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Duplication of the dystroglycan gene in most branches of teleost fish</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Pavoni</snm>
               <fnm>Ernesto</fnm>
               <insr iid="I1"/>
               <email>ernesto.pavoni@icrm.cnr.it</email>
            </au>
            <au id="A2">
               <snm>Cacchiarelli</snm>
               <fnm>Davide</fnm>
               <insr iid="I1"/>
               <email>davide.kun@gmail.com</email>
            </au>
            <au id="A3">
               <snm>Tittarelli</snm>
               <fnm>Roberta</fnm>
               <insr iid="I1"/>
               <email>roberta.tittarelli@tin.it</email>
            </au>
            <au id="A4">
               <snm>Orsini</snm>
               <fnm>Massimiliano</fnm>
               <insr iid="I2"/>
               <email>orsini@crs4.it</email>
            </au>
            <au id="A5">
               <snm>Galtieri</snm>
               <fnm>Antonio</fnm>
               <insr iid="I3"/>
               <email>galtieri@isengard.unime.it</email>
            </au>
            <au id="A6">
               <snm>Giardina</snm>
               <fnm>Bruno</fnm>
               <insr iid="I1"/>
               <email>bruno.giardina@icrm.cnr.it</email>
            </au>
            <au id="A7" ca="yes">
               <snm>Brancaccio</snm>
               <fnm>Andrea</fnm>
               <insr iid="I1"/>
               <email>andrea.brancaccio@icrm.cnr.it</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>CNR, Istituto di Chimica del Riconoscimento Molecolare c/o Istituto di Biochimica e Biochimica Clinica, Universit&#224; Cattolica del Sacro Cuore, Largo F. Vito 1, 00168 Roma, Italy</p>
            </ins>
            <ins id="I2">
               <p>CRS4 Bioinformatic Unit Parco Scientifico e Tecnologico POLARIS 09010 Pula (CA), Italy</p>
            </ins>
            <ins id="I3">
               <p>Dipartimento di Chimica Organica e Biologica, Universit&#224; di Messina, 98122 Messina, Italy</p>
            </ins>
         </insg>
         <source>BMC Molecular Biology</source>
         <issn>1471-2199</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>34</fpage>
         <url>http://www.biomedcentral.com/1471-2199/8/34</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17509131</pubid>
               <pubid idtype="doi">10.1186/1471-2199-8-34</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>21</day>
               <month>12</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>17</day>
               <month>5</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>17</day>
               <month>5</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Pavoni et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The dystroglycan (DG) complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: &#945;-DG, extracellular and highly glycosylated, and the transmembrane &#946;-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (<it>DAG1</it>) has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, <it>D. rerio </it>(zebrafish) seems to have a single copy of <it>DAG1</it>, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD) event, many teleost fish acquired multiple copies of several genes (paralogues).</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Data mining of pufferfish (<it>T. nigroviridis </it>and <it>T. rubripes</it>) and other teleost fish (<it>O. latipes </it>and <it>G. aculeatus</it>) available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in <it>T. nigroviridis</it>. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by <it>DAG1 </it>in mammals and <it>D. rerio</it>. A similar scenario emerged also in <it>D. labrax </it>(sea bass), from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (<it>T. bernacchii </it>and <it>C. hamatus</it>).</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish) involved also <it>DAG1</it>. We unravelled new important molecular genetic details about fish orthologous DGs, which might help to increase the current knowledge on DG expression, maturation and targeting and on its physiopathological role in higher organisms.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Dystroglycan (DG) is a cell surface adhesion complex, originally isolated from rabbit skeletal muscle, representing the pivotal element of a multimeric complex defined as dystrophin-glycoprotein complex (DGC). In mammals <it>DAG1 </it>possesses an uncomplicated exon-intron-exon structure, and its transcription and translation generates a precursor protein that is post-translationally cleaved into two noncovalently associated subunits: the highly glycosylated extracellular &#945;-DG and the transmembrane &#946;-DG <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. The DG subunits are believed to establish a molecular bridge linking the extracellular matrix to the cytoskeleton <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. In skeletal muscle and in a wide variety of tissues &#945;-DG binds extracellular matrix molecules, such as laminins, agrins and perlecan, and interacts non covalently with &#946;-DG, that binds dystrophin via its cytoplasmic tail <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Several cDNA sequences, which in most cases correspond to a highly conserved protein product 895 aa long, have been reported in different organisms such as human, mouse, dog, amphibia and fish DGs. The degree of sequence identity among mammals is remarkably high (> 90%), while the recently identified cDNA sequences of <it>X. laevis </it>and <it>D. rerio </it>(zebrafish) confirm that a very high degree of similarity is found also in lower vertebrate species <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>.</p>
         <p>DG is believed to have an increasingly important role in human health, being involved in pathological processes ranging from cancer progression to infective diseases <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. In particular, in human skeletal muscle DG, as well as several proteins belonging to the DGC (like dystrophin and sarcoglycans), is involved in severe forms of muscular diseases <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. On the other hand, until now there are no reports about muscular diseases directly generated by <it>DAG1 </it>mutations (primary dystroglycanopathies), not surprisingly since the DG knockout experiment in mice causes an early arrest of the embryonic development (at day 6.5), due to the disruption of the Reichert's membrane <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. However, in particular muscular diseases, known as congenital dystrophies (Muscle-Eye-Brain disease, MEB; Fukuyama Congenital Muscular Dystrophy, FCMD; Walker-Warburg Syndrome, WWS), mutations in different genes encoding for glycosyltransferases are regarded to generate an abnormal glycosylation of &#945;-DG <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. This alteration of the glycosylation pattern of &#945;-DG compromises its binding to extracellular matrix molecules and it is thought to be the reason for the progressive muscle fibre degeneration; this kind of human congenital disorders have been defined as "secondary dystroglycanopathies" <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>In the last years, a large body of knowledge originated from comparative biochemical and physiological studies about dystroglycan and the dystrophin glycoprotein complex in <it>D. rerio </it><abbrgrp><abbr bid="B5">5</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>, which showed that DG indeed plays a crucial role for adult skeletal muscle stability <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. With the aim of carrying out an expanded genetic and biochemical comparative analysis, we examined <it>DAG1 </it>from several fish species; besides <it>D. labrax </it>(sea bass) and <it>D. rerio </it>(zebrafish), we also analysed pufferfish characterized by compact genomes (<it>T. nigroviridis </it>and <it>T. rubripes</it>), other teleosts such as <it>O. latipes </it>(medaka) and <it>G. aculeatus </it>(stickleback), and Antarctic species (<it>T. bernacchii </it>and <it>C. hamatus</it>). So far it was generically assumed that all vertebrate species would share only one copy of <it>DAG1</it>, even if a whole genome duplication (WGD) event, involving a large number of genes, has been described in Actinopterygii <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Although a DG gene duplication event has not been identified in <it>D. rerio </it><abbrgrp><abbr bid="B5">5</abbr></abbrgrp>, our computer mining of genomic data available for pufferfish indicates that two different DG sequences are present. Accordingly, via the analysis of DNAs (and cDNAs) from <it>T. nigroviridis</it>, we identified two functional paralogous DG sequences, hereinafter defined as <it>DAG1a </it>and <it>DAG1b</it>. Moreover, for the first time we have cloned and sequenced <it>DAG1 </it>in sea bass (<it>D. labrax</it>), showing that it contains an additional mini-intronic sequence of about 150 bp, which is properly spliced out upon transcription.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Analysis of DAG1a and DAG1b sequences</p>
            </st>
            <p>Two paralogous genomic DNA sequences, for <it>T. rubripes </it>and <it>T. nigroviridis </it>respectively, were found at the Ensembl database <url>http://www.ensembl.org</url> already catalogued as <it>DAG1 </it>under the GenBank accession numbers reported in Table <tblr tid="T1">1</tblr>. In the same databank other DG sequences were also found for <it>O. latipes </it>and <it>G. aculeatus</it>. Using the program ClustalW, we have obtained a multiple alignment of the newly identified fish DG sequences together with those from human and mouse (Fig. <figr fid="F1">1</figr>). In addition, we have reported (Table <tblr tid="T2">2</tblr>) the reciprocal scores originating from the ClustalW alignment in Fig. <figr fid="F1">1</figr>, from which it can be seen that the similarity is higher between the orthologues of DAG1a or DAG1b proteins that between paralogous DG proteins within the same species (Table <tblr tid="T2">2</tblr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Multiple alignment of dystroglycan amino acid sequences obtained using the ClustalW software</p>
               </caption>
               <text>
                  <p>Multiple alignment of dystroglycan amino acid sequences obtained using the ClustalW software. The DG protein sequences from <it>T. rubripes</it>, <it>T. nigroviridis</it>, <it>O. latipes </it>and <it>G. aculeatus </it>are the conceptual translations of genomic available DNA sequences. Identical residues are highlighted in yellow. The cyan highlighting identifies the first intron insertion site and the red highlighting identifies the insertion site of the mini-intron. It should be noted that due to some possible sequencing mistakes, the 3' end of <it>T. rubripes DAG1a</it>, and therfore the corresponding C-terminal amino acid sequence, is not fully available in the Ensembl databank. The &#945;/&#946; cleavage site is also highlighted (black) while the green highlighting identifies the &#946;-DG binding epitope and the cyan one the &#945;-DG binding epitope [39,40]. The regions chosen for designing the two primers (FISH_ext_s and FISH_ext_as) used for the DG-homologous cloning experiment in <it>D. labrax </it>are indicated by red arrows.</p>
               </text>
               <graphic file="1471-2199-8-34-1"/>
            </fig>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>DG genes details based on genomic DNA sequences available at the Ensembl databank</p>
               </caption>
               <tblbdy cols="11">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>gene structure exon/intron (bp)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="11">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>SPECIES</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>GENE</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>ID ENSEMBL</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>GENOME LOCATION</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>exon1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>intron1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>exon2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>mini-intron</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>exon3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>total length (bp)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>precursor (aa)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="11">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>H. sapiens</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSG00000173402</p>
                     </c>
                     <c ca="center">
                        <p>chromosome 3</p>
                     </c>
                     <c ca="center">
                        <p>285</p>
                     </c>
                     <c ca="center">
                        <p>19977</p>
                     </c>
                     <c ca="center">
                        <p>2403</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>22665</p>
                     </c>
                     <c ca="center">
                        <p>895</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>M. musculus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSMUSG00000039952</p>
                     </c>
                     <c ca="center">
                        <p>chromosome 9</p>
                     </c>
                     <c ca="center">
                        <p>279</p>
                     </c>
                     <c ca="center">
                        <p>8351</p>
                     </c>
                     <c ca="center">
                        <p>2403</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>11033</p>
                     </c>
                     <c ca="center">
                        <p>893</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. rerio</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSDARG00000016153</p>
                     </c>
                     <c ca="center">
                        <p>chromosome 22</p>
                     </c>
                     <c ca="center">
                        <p>321</p>
                     </c>
                     <c ca="center">
                        <p>15186</p>
                     </c>
                     <c ca="center">
                        <p>2280</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>17787</p>
                     </c>
                     <c ca="center">
                        <p>866</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. rubripes</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NEWSINFRUG00000153220</p>
                     </c>
                     <c ca="center">
                        <p>scaffold 2682</p>
                     </c>
                     <c ca="center">
                        <p>336</p>
                     </c>
                     <c ca="center">
                        <p>2938</p>
                     </c>
                     <c ca="center">
                        <p>435</p>
                     </c>
                     <c ca="center">
                        <p>137</p>
                     </c>
                     <c ca="center">
                        <p>> 1689</p>
                     </c>
                     <c ca="center">
                        <p>> 5674</p>
                     </c>
                     <c ca="center">
                        <p>> 820</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. rubripes</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NEWSSINFRUG00000136139</p>
                     </c>
                     <c ca="center">
                        <p>scaffold 75</p>
                     </c>
                     <c ca="center">
                        <p>366</p>
                     </c>
                     <c ca="center">
                        <p>818</p>
                     </c>
                     <c ca="center">
                        <p>2307</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>3491</p>
                     </c>
                     <c ca="center">
                        <p>890</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GSTEN00009405001</p>
                     </c>
                     <c ca="center">
                        <p>scaffold SCAF11228</p>
                     </c>
                     <c ca="center">
                        <p>?</p>
                     </c>
                     <c ca="center">
                        <p>> 606</p>
                     </c>
                     <c ca="center">
                        <p>441</p>
                     </c>
                     <c ca="center">
                        <p>137</p>
                     </c>
                     <c ca="center">
                        <p>1857</p>
                     </c>
                     <c ca="center">
                        <p>> 3041</p>
                     </c>
                     <c ca="center">
                        <p>> 765</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GSTENG00033210001</p>
                     </c>
                     <c ca="center">
                        <p>scaffold SCAF15033</p>
                     </c>
                     <c ca="center">
                        <p>369</p>
                     </c>
                     <c ca="center">
                        <p>779</p>
                     </c>
                     <c ca="center">
                        <p>2313</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>3461</p>
                     </c>
                     <c ca="center">
                        <p>893</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>O. latipes</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSORLG00000010935</p>
                     </c>
                     <c ca="center">
                        <p>chromosome 5</p>
                     </c>
                     <c ca="center">
                        <p>297</p>
                     </c>
                     <c ca="center">
                        <p>22628</p>
                     </c>
                     <c ca="center">
                        <p>459</p>
                     </c>
                     <c ca="center">
                        <p>86</p>
                     </c>
                     <c ca="center">
                        <p>1818</p>
                     </c>
                     <c ca="center">
                        <p>25288</p>
                     </c>
                     <c ca="center">
                        <p>857</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>O. latipes</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSORLG00000009878</p>
                     </c>
                     <c ca="center">
                        <p>chromosome 7</p>
                     </c>
                     <c ca="center">
                        <p>312</p>
                     </c>
                     <c ca="center">
                        <p>839</p>
                     </c>
                     <c ca="center">
                        <p>2283</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>3434</p>
                     </c>
                     <c ca="center">
                        <p>864</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G. aculeatus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSGACG00000003062</p>
                     </c>
                     <c ca="center">
                        <p>group XVII 379.49 k</p>
                     </c>
                     <c ca="center">
                        <p>?</p>
                     </c>
                     <c ca="center">
                        <p>?</p>
                     </c>
                     <c ca="center">
                        <p>462</p>
                     </c>
                     <c ca="center">
                        <p>116</p>
                     </c>
                     <c ca="center">
                        <p>1827</p>
                     </c>
                     <c ca="center">
                        <p>> 2405</p>
                     </c>
                     <c ca="center">
                        <p>> 762</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G. aculeatus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ENSGACG00000002661</p>
                     </c>
                     <c ca="center">
                        <p>group XII 444.80 k</p>
                     </c>
                     <c ca="center">
                        <p>312</p>
                     </c>
                     <c ca="center">
                        <p>1026</p>
                     </c>
                     <c ca="center">
                        <p>2301</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>3639</p>
                     </c>
                     <c ca="center">
                        <p>870</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. labrax</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NCBI accession code DQ149510</p>
                     </c>
                     <c ca="center">
                        <p>?</p>
                     </c>
                     <c ca="center">
                        <p>?</p>
                     </c>
                     <c ca="center">
                        <p>?</p>
                     </c>
                     <c ca="center">
                        <p>> 90</p>
                     </c>
                     <c ca="center">
                        <p>116</p>
                     </c>
                     <c ca="center">
                        <p>> 1783</p>
                     </c>
                     <c ca="center">
                        <p>> 1989</p>
                     </c>
                     <c ca="center">
                        <p>> 624</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Details relative to the newly identified partial DG sequence from <it>D. labrax </it>are also included.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Reciprocal alignment scores of human and fish <it>DAG1 </it>genes obtained with ClustalW</p>
               </caption>
               <tblbdy cols="11">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>H. sapiens DAG1</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>D. labrax DAG1a</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>T. nigroviridis DAG1a</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>T. rubripes DAG1a</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>O. latipes DAG1a</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>G. aculeatus DAG1a</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>T. nigroviridis DAG1b</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>T. rubripes DAG1b</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>O. latipes DAG1b</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>G.  aculeatus  DAG1b</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="11">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>H. sapiens DAG1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. labrax DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>84</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>80</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>80</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>90</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>68</p>
                     </c>
                     <c ca="center">
                        <p>68</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>69</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>84</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>77</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>73</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>79</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. rubripes DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>80</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>77</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>68</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>74</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>O. latipes DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>80</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>73</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>68</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>78</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G. aculeatus DAG1a</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>90</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>79</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>74</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>78</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>65</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>68</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>-</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>90</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>75</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>80</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. rubripes DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>68</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>90</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>-</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>74</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>79</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>O. latipes DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>75</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>74</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>-</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>75</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G. aculeatus DAG1b</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>69</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>65</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>80</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>79</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>75</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>-</b>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>The <it>DAG1a </it>and <it>DAG1b </it>orthologues have been highlighted in bold.</p>
               </tblfn>
            </tbl>
            <p>The <it>T. rubripes DAG1a </it>is 5674 bp long, starting from the putative transcription start site up to the stop codon, and consists of three exons separated by two introns. The same structure is present in <it>T. nigrovoridis DAG1a</it>, although the 5' region has not yet been clearly annotated in the Ensembl database. The 5' region of <it>G. aculeatus DAG1a </it>gene is still partially defined as well, even if we have been able to recognize the typical "exon2-mini-intron-exon3" structure. This arrangement is also present in <it>O. latipes DAG1a</it>, although a peculiar feature of this gene is its very long second intron spanning &#8776; 22 kb (Table <tblr tid="T1">1</tblr>). <it>DAG1b </it>paralogous genes from pufferfish (<it>T. nigrovoridis </it>and <it>T. rubripes</it>), from <it>G. aculeatus </it>and <it>O. latipes </it>contain two exons, of 310&#8211;360 and ~ 2300 bp respectively, separated by only one intron (800&#8211;1000 bp) which is much shorter than the one typically present in human (19977 bp) or zebrafish (14512 bp) gene sequences (see Table <tblr tid="T1">1</tblr>).</p>
         </sec>
         <sec>
            <st>
               <p>Cloning of the D. labrax DG gene</p>
            </st>
            <p>The gene fishing experiment that allowed the cloning of the <it>D. labrax </it>(sea bass) <it>DAG1 </it>was performed using a primer pair, FISH_ext_s and FISH_ext_as (Table <tblr tid="T3">3</tblr>), specifically designed in order to closely match two highly conserved regions identified by aligning the <it>DAG1 </it>sequences from <it>D. rerio </it>and <it>T. rubripes </it>(see Fig. <figr fid="F1">1</figr>). The PCR reaction, performed using genomic DNA extracted from <it>D. labrax </it>skeletal muscle as template, produced a fragment of ~ 2000 bp, displaying a longer size than the one expected from the <it>D. rerio </it>and <it>T. rubripes </it>DG sequences. Indeeed, cloning and sequencing of this fragment revealed the presence of an additional 116 bp mini-intron. The nucleotides at the splice site of the exon/mini-intron boundary conformed to the GT-AG rule. The newly identified DG sequence from <it>D. labrax </it>is 1990 bp long; it encodes for a 624 amino acids sequence (deposited under the accession number DQ149510), spanning a portion of the &#945;-DG N-terminal region and protruding through almost the entire &#946;-DG region. The amino acid alignment between this sequence and that of DG from <it>D. rerio </it>shows a 76.9% identity in a 631 residues overlap (Fig. <figr fid="F1">1</figr>). Based on the alignment score with other vertebrate sequences, our new DG sequence from <it>D. labrax </it>is likely to correspond to the <it>DAG1a </it>family of sequences (see Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Primers used in the PCR experiments</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Fish</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Primer</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sequence primer (5'-3')</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. rerio</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>DAG1_s</p>
                     </c>
                     <c ca="center">
                        <p>CCAGCCTTTCATCTGTGGCAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. rerio</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>DAG1_as</p>
                     </c>
                     <c ca="center">
                        <p>CTTCGCACCCTTTTGGGCAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. rerio</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACT_s</p>
                     </c>
                     <c ca="center">
                        <p>TCTTGACCCTGAAGTACCCCATT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. rerio</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACT_as</p>
                     </c>
                     <c ca="center">
                        <p>TCCTTGATGTCGCGCACAAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. labrax</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>FISH_ext_s</p>
                     </c>
                     <c ca="center">
                        <p>GGGCTTCAGCACATGAAGAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. labrax</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>FISH_ext_as</p>
                     </c>
                     <c ca="center">
                        <p>CTGTAGGG(A/G)GTCATGTTCTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. labrax</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACT s</p>
                     </c>
                     <c ca="center">
                        <p>TCCTGACCCTGAAGTACCCCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>D. labrax</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACT as</p>
                     </c>
                     <c ca="center">
                        <p>TTGATGTCACGCACGATTTCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>DAG1a s</p>
                     </c>
                     <c ca="center">
                        <p>CAGACGTTCCTGTGTGAGGGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>DAG1a as</p>
                     </c>
                     <c ca="center">
                        <p>GCTTCGGAAGGTGCTGCTTC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>DAG1b s</p>
                     </c>
                     <c ca="center">
                        <p>AGCTCAGCCTCTCACCTGTAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>DAG1b as</p>
                     </c>
                     <c ca="center">
                        <p>GACTCGTTTCACTCCATGGACC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACT s</p>
                     </c>
                     <c ca="center">
                        <p>CACCCTGAAGTATCCCATCGAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>T. nigroviridis</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACT as</p>
                     </c>
                     <c ca="center">
                        <p>GTCTCTGACGATCTCTCGCTCAG</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>The primers used to amplify the gene sequences from <it>D. rerio </it>and <it>T. nigroviridis </it>were designed using the sequences available in the database. The degenerate primers FISH_ext_s and FISH_ext_as, which allowed the fishing of the newly identified <it>D. labrax </it>sequence, were chosen exploiting two regions displaying very high homology within the aligned DG sequences from <it>D. rerio </it>and <it>T. rubripes </it>(see also Fig. 1).</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Paralogous pufferfish DAG genes are correctly spliced</p>
            </st>
            <p>PCR analysis suggested that the mini-intron sequence of 137 bp would be properly spliced in <it>T. nigroviridis</it>, since shorter bands emerged from the analysis of cDNA samples with respect of genomic DNAs (Fig. <figr fid="F2">2</figr>). This hypothesis was strongly supported by the evidence of a conservation of several typical intron consensus sequences, such as the donor, the acceptor splice site, the branching site and the typical pyrimidin rich-region too (data not shown). A PCR experiment carried out using a primer pair flanking the mini-intron region (see Table <tblr tid="T3">3</tblr>), produced two fragments displaying a different size when genomic DNA or retro-transcribed cDNA were respectively used as template. The two DNA fragments differ for the presence of the mini-intron sequence, confirming the splicing-out of the mini-intron sequence within the RNA. RT-PCR demonstrated that both <it>DAG1a </it>and <it>DAG1b </it>genes are transcribed and are likely to be expressed. In <it>D. rerio </it>the amplified fragment shows the expected size confirming the presence of a single <it>DAG1 </it>in zebrafish and the actin control experiment demonstrated that the cDNA was totally free from any possible genomic DNA contamination (Fig. <figr fid="F2">2</figr>).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>1% agarose gel electrophoresis of the PCR reaction products, carried out using a couple of specific primers (whose sequences are reported in Table 1) flanking the mini-intron region of <it>DAG1a </it>and its counterpart region in <it>DAG1b </it>from <it>T</it></p>
               </caption>
               <text>
                  <p>1% agarose gel electrophoresis of the PCR reaction products, carried out using a couple of specific primers (whose sequences are reported in Table 1) flanking the mini-intron region of <it>DAG1a </it>and its counterpart region in <it>DAG1b </it>from <it>T. nigroviridis</it>. The cartoon on the left refers to the different reaction products obtained with appropriate primers (depicted as arrows). The mini-intron is evidenced by an asterisks. The two DNA fragments obtained using respectively genomic or cDNA as a template, differ for the presence of the mini-intron sequence, demonstrating the splicing-out of the mini-intron sequence in <it>T. nigroviridis</it>.</p>
               </text>
               <graphic file="1471-2199-8-34-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Western blot analysis of &#946;-DG</p>
            </st>
            <p>To evaluate the expression of DG in the species analysed, skeletal muscle total protein extracts, partially purified upon a WGL-enrichment protocol (as described in Methods), were tested via Western blot, and the presence of &#946;-DG was revealed using the commercially available monoclonal antibody anti-&#946;-DG 43DAG. This antibody is able to recognize the last portion (15 aa) of the C-terminal cytodomain of &#946;-DG, harbouring the dystrophin binding site <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> (see Fig. <figr fid="F1">1</figr>). The identified band of &#8776; 43 kDa clearly corresponds to &#946;-DG and confirms its expression in all the samples analysed (Fig. <figr fid="F3">3</figr>). A small mobility shift was recorded that could depend on slight differences in the levels of glycosylation of the &#946; subunit. In <it>T. nigroviridis </it>two bands for &#946;-DG were detected while an additional &#8776; 30 kDa band was identified in <it>C. hamatus </it>(Fig. <figr fid="F3">3</figr>). It is noteworthy that in mammals a proteolytic fragment of the same size was related to a series of severe pathologies, including cancer progression <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. At the present stage, we could not assess whether such fragment would originate from some proteolytic events or whether it would be an alternative expression product of a putative paralogous copy of <it>DAG1 </it>in this species.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Western blot analysis performed using an anti &#946;-DG antibody versus a DGC enriched protein extract of skeletal muscle from different teleost species (4 &#956;g for each lane)</p>
               </caption>
               <text>
                  <p>Western blot analysis performed using an anti &#946;-DG antibody versus a DGC enriched protein extract of skeletal muscle from different teleost species (4 &#956;g for each lane). Lane: 1) <it>D. labrax</it>; lane 2) <it>T. nigroviridis</it>, lane 3) <it>T. bernacchii</it>; lane 4) <it>C. hamatus</it>; lane 5) <it>D. rerio</it>.</p>
               </text>
               <graphic file="1471-2199-8-34-3"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>During recent years, the biological role of dystroglycan (DG) in higher vertebrates has been in part elucidated. The DG adhesion complex, composed of two subunits (&#945; and &#946;), is a pivotal member of a large transmembraneous group of glycoproteins associated with the cytoskeleton representing, together with integrins, the major molecular bridge involved in the formation and stabilization of contacts at the cell/extracellular matrix interface during embryogenesis and in a wide variety of adult tissues <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B17">17</abbr></abbrgrp>. In mice, the concerted action of DG and laminin is believed to trigger the initial phase of embryogenesis, when the first contacts between cells and basement membranes are established. In fact, <it>DAG1 </it>knockout mice exhibit gross developmental abnormalities beginning around 6.5 days of gestation, while in contrast heterozygous mice are viable and fertile <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. However, the role of DG during embryogenesis remains controversial. Although no mutations have been identified so far in human populations, thus confirming the DG crucial primary role during peri-implantation in mammals, knock-out experiments in zebrafish showed that early development remained unaffected by the absence of DG while a severe dystrophic phenotype emerged during adulthood <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>.</p>
         <p>The comparison of <it>DAG1 </it>among different vertebrate species, including several fish species and even antarctic ones, which typically underwent the evolutionary process of cold-adaptation, could be useful to understand how the selection pressure influenced the actual organization of <it>DAG1 </it>in fish and the whole genome duplication process. In fact, several lines of evidence suggest that a whole-genome duplication (WGD) event occurred within the teleost lineage after separation from the tetrapod lineage, and that only a subset of duplicates have been retained in modern teleost genomes <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. The analysis of genomic sequences obtained from zebrafish and pufferfish provided further evidence for WGD during the evolution of ray-finned fish (Actinopterygii) <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B20">20</abbr></abbrgrp>. It was estimated that WGD should have taken place about 350 Myr ago, after the separation of ray-finned and lobe-finned fish, but before the origination of teleost fish <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. While several duplicated genes were subsequently lost, many others were maintained during evolution. Preserved genes might have underwent small changes and adopted slightly different functions and this might have further protected the gene from being lost <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. These assumptions are of primary importance when searching for possible orthologous versions of mammalian genes in fish genomes <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>.</p>
         <p>The major piece of data collected so far on the structure and function of <it>DAG1 </it>in zebrafish is the work published by Parsons and colleagues, which shows that the inactivation of the DG gene by antisense morpholino oligonucleotides causes severe muscular dystrophy in the adult stage <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Genome analysis reveals that only one copy of <it>DAG1 </it>is present in <it>D. rerio</it>, displaying the typical uncomplicated exon/intron mammalian structure <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. On the other hand, the analysis of available genomic sequence drafts from <it>T. rubripes</it>, <it>T. nigroviridis</it>, <it>O. latipes </it>and <it>G. aculeatus</it>, reveals the presence of two ORFs encoding DG, that we here name as <it>DAG1a </it>and <it>DAG1b</it>, based on their alignment scores with respect to other mammalian DGs and in particular to human DG (see Fig. <figr fid="F1">1</figr>, Table <tblr tid="T1">1</tblr> and <tblr tid="T2">2</tblr>).</p>
         <p>Surprisingly, the gene copy that we propose to define <it>DAG1a</it>, displays a novel intronic sequence at the level of the region corresponding to the second exon. The intron is very short in size: 137 bp in <it>T. rubripes and T. nigroviridis</it>, 116 bp in <it>G. aculeatus and D. labrax </it>and only 86 bp in <it>O. latipes </it>(see Table <tblr tid="T1">1</tblr>) in close similarity with the shortest sizes of introns already identified in other species <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. The gain of this "mini-intron" did not produce any frameshift affecting the resulting protein sequence, as also demonstrated by our Western blot results (see below). Accordingly, experiments performed with specific primer pairs designed for both <it>DAG1a </it>and <it>DAG1b</it>, reveals that in pufferfish both the <it>DAG1 </it>copies are transcribed and therefore likely to be functional and expressed (Fig. <figr fid="F2">2</figr>). This result was somehow anticipated by the high conservation of both paralogous <it>DAG1 </it>sequences and by the absence of nonsense mutations or any other major genetic alteration that would imply a drift towards a pseudogene status. In fact, pseudogenes are known to constantly drift until they are either deleted or become unrecognizable <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. However, further analysis will be needed to investigate in detail such intron gaining event <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>.</p>
         <p>As already reported for several other genes, it is likely that <it>DAG1 </it>underwent duplication as part of the whole genome duplication (WGD) event that took place during the Actinopterygii speciation process <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B25">25</abbr></abbrgrp> (black arrow in Fig. <figr fid="F4">4</figr>) and subsequently a sporadic gain of a mini-intronic sequence took place either before the separation between Ostariophysi and Acanthopterygii (green arrow in Fig. <figr fid="F4">4</figr>) or afterwards (red arrow).</p>
         <fig id="F4">
            <title>
               <p>Figure 4</p>
            </title>
            <caption>
               <p>Phylogenetical tree of the different fish species under analysis built using the taxonomical information available at the NCBI database</p>
            </caption>
            <text>
               <p>Phylogenetical tree of the different fish species under analysis built using the taxonomical information available at the NCBI database. Origin of fish pictures: the images have been downloaded from freely available web resources and extensively readapted. The black arrow represent the whole genome duplication (WGD) event, involving also the DG gene, that took place during the Actinopterygii speciation. The two additional arrows (green and red) mark hypothetical timings of the mini-intron gaining event.</p>
            </text>
            <graphic file="1471-2199-8-34-4"/>
         </fig>
         <p>In <it>D. labrax </it>(sea bass), the result of our homologous cloning strategy for DG fishing was a gene fragment of &#8776; 2000 bp (data not shown), including a sequence corresponding to a 116 bp mini-intron which, based on the alignment score, can be assigned to the family of <it>DAG1a </it>sequences (Table <tblr tid="T3">3</tblr>). The expression of DG was preliminary tested by Western blot using a monoclonal antibody directed versus the C-terminal tail of the &#946;-DG subunit, since this region is highly conserved in all the vertebrates <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. In fact, positive signals of 43 kDa were detected in all the samples analysed, including antarctic species <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. Up to now, any attempt at homologous cloning of DG sequences from antarctic species exploiting the same primers employed for <it>D. labrax </it>DG were unsuccessful. Therefore, further experiments employing new designed degenerate primers will be required in order to clone the DG sequences from antarctic species.</p>
         <p>The secondary structure of the &#945;-DG N-terminal region of <it>T. rubripes</it>, predicted from the gene sequence (both <it>DAG1a </it>and <it>DAG1b</it>) exploiting SSpro software <url>http://www.igb.uci.edu/tools/scratch</url><abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp> (data not shown), suggests a significant similarity with the &#945;-helical and &#946;-strand elements detected in the crystal structure of mouse &#945;-DG N-terminal domain that was recently solved <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. This region is composed by two autonomous domains: an Ig-like one, and the second one resembling ribosomal RNA-binding protein S6. Moreover, additional predictions performed using NetOGlyc software, confirm the presence of a mucin-like domain also in the central region of teleost &#945;-DGs. It is noteworthy that the &#946;-DG binding epitope, spanning the amino acid positions 550&#8211;565 of the C-terminal domain of &#945;-DG, is highly conserved also in fish <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. In contrast, its counterpart, the putative &#945;-DG binding epitope spanning the amino acidic positions 691&#8211;719 in &#946;-DG, displays a much lower degree of identity with the mammalian one, with few exceptions, such as the conservation of Phe692 and Phe718, which have been shown to play a crucial role in the &#945;/&#946; subunits interface formation (Fig. <figr fid="F1">1</figr>) <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Another region highly conserved is the C-terminal domain of &#946;-DG which contains the dystrophin binding site <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B30">30</abbr><abbr bid="B36">36</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Our analysis clearly shows that the WGD event that took place in Actinopterygii involved also <it>DAG1</it>. During evolution, WGD events are expected to have had a high impact on speciation. To fully understand this impact means to unravel all the genetic and molecular details underlying the speciation process, and the knowledge of which genes were retained in duplicate and how the duplication modified their evolutionary fitness is crucial to that aim. Generally, the functional consequences of WGD in fish have been mitigated both by partial gene loss and acquisition of new useful functions <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. Indeed, in some cases the presence of two functional copies of an important gene like DG, could have represented an improvement of their fitness. The morpholino oligos-driven disruption of DG in zebrafish results in the emergence of a severe dystrophic phenotype in adults that could not be alleviated or compensated by a paralogue isoform of DG <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>.</p>
         <p>The importance of fish model systems for the study of Duchenne muscular dystrophy and other human muscular diseases is clearly emerging, as highlighted by the work carried out in Kunkel's lab <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Due to the important role played by DG in human congenital muscular disorders, comparative genetic and biochemical analyses could be particularly relevant in the race for fully elucidating its function or misfunction in severe diseases, eventually leading to innovative therapeutical strategies related to DG. For example, the DG's high affinity towards the proteoglycan agrin has been one of the factors leading to the design of miniaturized agrin, rescuing the dy/dy dystrophic phenotype in mice <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>.</p>
         <p>A comprehensive understanding of the biological implications of <it>DAG1 </it>duplication in some teleost fish species may have unexpected repercussions on the view of "secondary dystroglycanopathies", since recently paralogue isoforms of glycosyltransferases thought to act specifically on DG (LARGE and POMT among others) were also identified and characterized <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp>. It is intriguing to hypothesize that in the future "evolution-inspired" gene therapy approaches, implying the introduction (or reintroduction) of a second <it>DAG1 </it>copy or isoform, will be used to alleviate the symptoms of dystrophy in human skeletal muscle.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Nucleic acids extraction and cDNA production</p>
            </st>
            <p>Genomic DNA was obtained by Sodium acetate/Chloroform extraction from tissues previously homogenised in a solubilization buffer and digested with Proteinase K (Sigma-Aldrich, USA). The Abs<sub>260 </sub>and Abs<sub>260</sub>/Abs<sub>280 </sub>ratios were used to determine DNA concentration and purity, respectively.</p>
            <p>Total RNA was extracted from tissues using the RNeasy Mini kit (Qiagen, Germany) specific for fibrous tissue. Using this protocol we observed a massive contamination with genomic DNA co-eluting with RNA. To avoid such contamination, a further step was added by loading the aqueous phase on an RNeasy column (Qiagen, Germany) and before elution the membrane was treated with DNase I. First strand cDNA was then synthesized using the Enhanced Avian RT-PCR kit (Sigma-Aldrich, USA) and used as a template for further PCR experiments.</p>
         </sec>
         <sec>
            <st>
               <p>PCR analysis and gene cloning</p>
            </st>
            <p>All the PCR reactions (50 &#956;l volume) were performed in a GeneAmp PCR System 2400 temperature cycler (Perkin Elmer) using 10 ng of cDNA as template, and 2.5 U of AccuTaq DNA polymerase (Sigma). As positive control we used, for each species, specific primers that amplify the actin gene (Table <tblr tid="T3">3</tblr>). PCR products were cloned into the pCR II-TOPO vector (Invitrogen) using a TOPO TA Cloning<sup>&#174; </sup>kit following the manufacturer's protocol. Plasmidic DNAs containing the cloned inserts were purified and submitted to automated sequencing. All the primers used in this analysis are reported in Table <tblr tid="T3">3</tblr>. The primers FISH_ext_s and FISH_ext_as were designed on two highly conserved regions identified aligning the sequences of <it>DAG1 </it>from <it>D. rerio </it>and <it>T. rubripes</it>. For <it>T. nigroviridis </it>we designed two primer pairs specific for <it>DAG1a </it>and <it>DAG1b</it>, respectively (Table <tblr tid="T3">3</tblr>). The specific primers ACT_s and ACT_as for actin genes of all the species where designed with an optimum GC concentration and an annealing temperature of 55&#176;C. In order to distinguish the amplified product from genomic DNA and from cDNA, ACT primers were designed into contiguous exons. The newly identified DG sequence of <it>D. labrax </it>has been deposited in Gene Bank and assigned the accession number DQ149510.</p>
         </sec>
         <sec>
            <st>
               <p>Sequence analysis</p>
            </st>
            <p>The multiple alignment of all the DG protein sequences under analysis has been obtained using ClustalW <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Based on their respective primary structure, a secondary structure prediction of the N-terminal region of the <it>DAG1a </it>and <it>DAG1b </it>products from <it>T. rubripes </it>was obtained using the program SSpro <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>. The propensity of an amino acidic stretch to be O-glycosylated was analysed using the NetOGlyc software <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Total protein extracts and WGL-enriched fraction preparation from tissues</p>
            </st>
            <p>Total protein extracts were obtained from skeletal muscle biopsies in the form of freshly frozen samples collected from all the species under analysis and stored at -80&#176;C until used. Tissue samples were homogenized in a solubilization buffer (50 mM Tris-HCl pH 7.4, 1 mM EDTA, 1 mM DTT, 1% SDS) and centrifuged to obtain a clean upper phase that was successively incubated with Wheat germ lectin (WGL) Sephorose 6 MB (Amersham, Sweden) to obtain DGC <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Western blot analysis of tissue samples were performed as described elsewhere <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>EP did all the experimental work including the collection, storage and homogenization of the fish tissue samples and also gave a major contribution to the writing of the manuscript and assembly of the final version of figures and tables. DC carried out some of the PCR experiments dealing with the identification of two expressed sequence in cDNA and readapted the fish pictures. MO carried out extensive sequence alignment analysis. RT carried out the Western blot analysis. AG and BG contributed to edit the manuscript. AB conceived the project, supervised the experiments and wrote the manuscript together with EP. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Manuela Bozzi and Francesca Sciandra for helpful comments and Maria Giulia Bigotti for critical reading of the manuscript. This work was partially supported by a grant of PNRA (Programma Nazionale di Ricerche in Antartide) to AB.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix</p>
            </title>
            <aug>
               <au>
                  <snm>Ibraghimov-Beskrovnaya</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ervesti</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Leveille</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Slaughter</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Sernett</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1992</pubdate>
            <volume>355</volume>
            <fpage>696</fpage>
            <lpage>702</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/355696a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">1741056</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin</p>
            </title>
            <aug>
               <au>
                  <snm>Ervasti</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>J Cell Biol</source>
            <pubdate>1993</pubdate>
            <volume>122</volume>
            <fpage>809</fpage>
            <lpage>823</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.122.4.809</pubid>
                  <pubid idtype="pmpid" link="fulltext">8349731</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Dystroglycan: from biosynthesis to pathogenesis of human disease</p>
            </title>
            <aug>
               <au>
                  <snm>Barresi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>J Cell Sci</source>
            <pubdate>2006</pubdate>
            <volume>119</volume>
            <fpage>199</fpage>
            <lpage>207</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1242/jcs.02814</pubid>
                  <pubid idtype="pmpid" link="fulltext">16410545</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Molecular cloning and expression analysis of dystroglycan during Xenopus laevis embryogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Lunardi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dente</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Mech Dev</source>
            <pubdate>2002</pubdate>
            <volume>119</volume>
            <fpage>S49</fpage>
            <lpage>54</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0925-4773(03)00091-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">14516660</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Removal of dystroglycan causes severe muscular dystrophy in zebrafish embryos</p>
            </title>
            <aug>
               <au>
                  <snm>Parsons</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Campos</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Hirst</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Stemple</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>2002</pubdate>
            <volume>129</volume>
            <fpage>3505</fpage>
            <lpage>3512</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12091319</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The dystroglycan complex: from biology to cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Sgambato</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Cell Physiol</source>
            <pubdate>2005</pubdate>
            <volume>205</volume>
            <fpage>163</fpage>
            <lpage>169</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jcp.20411</pubid>
                  <pubid idtype="pmpid" link="fulltext">15920757</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Three muscular dystrophies: loss of cytoskeleton-extracellular matrix linkage</p>
            </title>
            <aug>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1995</pubdate>
            <volume>80</volume>
            <fpage>675</fpage>
            <lpage>679</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(95)90344-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">7889563</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Dystroglycan is essential for early embryonic development: disruption of Reichert's membrane in Dag1-null mice</p>
            </title>
            <aug>
               <au>
                  <snm>Williamson</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Henry</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Daniels</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Hrstka</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Sunada</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ibraghimov-Beskrovnaya</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>1997</pubdate>
            <volume>6</volume>
            <fpage>831</fpage>
            <lpage>41</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/6.6.831</pubid>
                  <pubid idtype="pmpid" link="fulltext">9175728</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies</p>
            </title>
            <aug>
               <au>
                  <snm>Michele</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Barresi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kanagawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Saito</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Cohn</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Satz</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Dollar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nishino</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Kelley</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Somer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Straub</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Mathews</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2002</pubdate>
            <volume>418</volume>
            <fpage>417</fpage>
            <lpage>422</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature00837</pubid>
                  <pubid idtype="pmpid" link="fulltext">12140558</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>POMT1 mutation results in defective glycosylation and loss of laminin-binding activity in &#945;-DG</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Hayashi</snm>
                  <fnm>YK</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ogawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Noguchi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Murakami</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sakuta</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mochizuki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Michele</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Nonaka</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Nishino</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Neurology</source>
            <pubdate>2004</pubdate>
            <volume>62</volume>
            <fpage>1009</fpage>
            <lpage>1011</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15037715</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>POMT2 mutations cause &#945;-dystroglycan hypoglycosylation and Walker-Warburg syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>van Reeuwijk</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Janssen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>van den Elzen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Beltran-Valero de Bernabe</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Sabatelli</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Merlini</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Boon</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Scheffer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Brockington</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Muntoni</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Huynen</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Verrips</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Walsh</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Barth</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Brunner</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>van Bokhoven</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Med Genet</source>
            <pubdate>2005</pubdate>
            <volume>42</volume>
            <fpage>907</fpage>
            <lpage>912</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jmg.2005.031963</pubid>
                  <pubid idtype="pmpid" link="fulltext">15894594</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Defective glycosylation in muscular dystrophy</p>
            </title>
            <aug>
               <au>
                  <snm>Muntoni</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Brockington</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Blake</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Torelli</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>2002</pubdate>
            <volume>360</volume>
            <fpage>1419</fpage>
            <lpage>1421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(02)11397-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12424008</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The dystrophin associated protein complex in zebrafish</p>
            </title>
            <aug>
               <au>
                  <snm>Guyon</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Mosley</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>O'Brien</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Sheng</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Chiang</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Davison</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Volinski</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Zon</snm>
                  <fnm>LI</fnm>
               </au>
               <au>
                  <snm>Kunkel</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Human Molecular Genetics</source>
            <pubdate>2003</pubdate>
            <volume>6</volume>
            <fpage>601</fpage>
            <lpage>615</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1093/hmg/12.6.601</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>&#948;-sarcoglycan is required for early zebrafish muscle organization</p>
            </title>
            <aug>
               <au>
                  <snm>Guyon</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Mosley</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Jun</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Montanaro</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Steffen</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nigro</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Zon</snm>
                  <fnm>LI</fnm>
               </au>
               <au>
                  <snm>Kunkel</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Exp Cell Res</source>
            <pubdate>2005</pubdate>
            <volume>304</volume>
            <fpage>105</fpage>
            <lpage>115</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.yexcr.2004.10.032</pubid>
                  <pubid idtype="pmpid" link="fulltext">15707578</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Sarcoglycans of the zebrafish: orthology and localization to the sarcolemma and myosepta of muscle</p>
            </title>
            <aug>
               <au>
                  <snm>Chambers</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>LV</fnm>
               </au>
               <au>
                  <snm>Maquire</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Dodd</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Love</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2003</pubdate>
            <volume>303</volume>
            <fpage>488</fpage>
            <lpage>495</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0006-291X(03)00355-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12659844</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Genome duplication, a trait shared by 22000 species of ray-finned fish</p>
            </title>
            <aug>
               <au>
                  <snm>Taylor</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Braasch</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Frickey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Van de Peer</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2003</pubdate>
            <volume>3</volume>
            <fpage>382</fpage>
            <lpage>390</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1101/gr.640303</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin</p>
            </title>
            <aug>
               <au>
                  <snm>Ervasti</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>J Cell Biol</source>
            <pubdate>1993</pubdate>
            <volume>122</volume>
            <fpage>809</fpage>
            <lpage>823</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.122.4.809</pubid>
                  <pubid idtype="pmpid" link="fulltext">8349731</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Anomalous dystroglycan in carcinoma cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Losasso</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Di Tommaso</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Sgambato</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ardito</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cittadini</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Giardina</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Petrucci</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>FEBS lett</source>
            <pubdate>2000</pubdate>
            <volume>484</volume>
            <fpage>1194</fpage>
            <lpage>1198</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0014-5793(00)02157-8</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Processing of &#946;-dystroglycan by matrix metalloproteinase disrupts the link between the extracellular matrix and the cell membrane via the dystroglycan complex</p>
            </title>
            <aug>
               <au>
                  <snm>Yamada</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Fumiaki</snm>
                  <fnm>Saito</fnm>
               </au>
               <au>
                  <snm>Hiroko</snm>
                  <fnm>FO</fnm>
               </au>
               <au>
                  <snm>Zhong</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hase</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Arai</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Okuyama</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Maekawa</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schimizu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Matsumura</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2001</pubdate>
            <volume>10</volume>
            <fpage>1563</fpage>
            <lpage>1569</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/10.15.1563</pubid>
                  <pubid idtype="pmpid" link="fulltext">11468274</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The zebrafish gene map defines ancestral vertebrate chromosomes</p>
            </title>
            <aug>
               <au>
                  <snm>Woods</snm>
                  <fnm>IG</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Friedlander</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Nix</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kelly</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Chu</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Postlethwait</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Talbot</snm>
                  <fnm>WS</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <fpage>1307</fpage>
            <lpage>1314</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1199546</pubid>
                  <pubid idtype="pmpid" link="fulltext">16109975</pubid>
                  <pubid idtype="doi">10.1101/gr.4134305</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Fugu genome analysis provides evidence for a whole-genome duplication early during the evolution of ray-finned fishes</p>
            </title>
            <aug>
               <au>
                  <snm>Christoffels</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Koh</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Chia</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Brenner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Aparicio</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Venkatesh</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2004</pubdate>
            <volume>21</volume>
            <fpage>1146</fpage>
            <lpage>1151</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msh114</pubid>
                  <pubid idtype="pmpid" link="fulltext">15014147</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>The evolutionary fate and consequences of duplicate genes</p>
            </title>
            <aug>
               <au>
                  <snm>Lynch</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Conery</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>290</volume>
            <fpage>1151</fpage>
            <lpage>1154</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.290.5494.1151</pubid>
                  <pubid idtype="pmpid" link="fulltext">11073452</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Preservation of duplicate genes by complementary, degenerative mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Force</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pickett</snm>
                  <fnm>FB</fnm>
               </au>
               <au>
                  <snm>Amores</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yan</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Postlethwait</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1999</pubdate>
            <volume>151</volume>
            <fpage>1531</fpage>
            <lpage>1545</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1460548</pubid>
                  <pubid idtype="pmpid" link="fulltext">10101175</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>More genes in fish?</p>
            </title>
            <aug>
               <au>
                  <snm>Wittbrodt</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Scharti</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>BioEssay</source>
            <pubdate>1998</pubdate>
            <volume>20</volume>
            <fpage>511</fpage>
            <lpage>515</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1002/(SICI)1521-1878(199806)20:6&lt;511::AID-BIES10>3.0.CO;2-3</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>The cellular retinol-binding protein genes are duplicated and differentially transcribed in the developing and adult zebrafish (Danio rerio)</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>RZ</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Thiesse</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Thiesse</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Denovan-Wright</snm>
                  <fnm>EM</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2005</pubdate>
            <volume>3</volume>
            <fpage>469</fpage>
            <lpage>477</lpage>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Human dystroglycan: skeletal muscle cDNA, genomic structure, origin of tissue specific isoforms and chromosomal localization</p>
            </title>
            <aug>
               <au>
                  <snm>Ibraghimov-Beskrovnaya</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Milatovich</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ozcelik</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Koepnick</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Francke</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>KP</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>1993</pubdate>
            <volume>2</volume>
            <fpage>1651</fpage>
            <lpage>1657</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/2.10.1651</pubid>
                  <pubid idtype="pmpid" link="fulltext">8268918</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Pyrimidine tracts between the 5' splice site and branch point facilitate splicing and recognition of a small Drosophila intron</p>
            </title>
            <aug>
               <au>
                  <snm>Kennedy</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Berget</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1997</pubdate>
            <volume>5</volume>
            <fpage>2774</fpage>
            <lpage>2780</lpage>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Genomic organization of the channel catfish CD45 functional gene and CD45 pseudogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Kountikov</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Quiniou</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Clem</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Bengten</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Immunogenetics</source>
            <pubdate>2005</pubdate>
            <volume>57</volume>
            <fpage>374</fpage>
            <lpage>83</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1352342</pubid>
                  <pubid idtype="pmpid" link="fulltext">15868142</pubid>
                  <pubid idtype="doi">10.1007/s00251-005-0797-z</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>The evolution of spliceosomal introns: patterns, puzzles and progress</p>
            </title>
            <aug>
               <au>
                  <snm>Roy</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Gilbert</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Nat Rev Genet</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <fpage>211</fpage>
            <lpage>221</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16485020</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Epitopes in the interacting regions of &#946;-dystroglycan (PPxY motif) and dystrophin (WW domain)</p>
            </title>
            <aug>
               <au>
                  <snm>Pereboev</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Ahmed</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>thi Man</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>GE</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>2001</pubdate>
            <volume>1527</volume>
            <fpage>54</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11420143</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>SCRATCH: a protein structure and structural feature prediction server</p>
            </title>
            <aug>
               <au>
                  <snm>Cheng</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Randall</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sweredoski</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baldi</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Research</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <fpage>72</fpage>
            <lpage>76</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1093/nar/gki396</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Improving the prediction of protein secondary structure in three and eight classes using recurrent neural networks and profiles</p>
            </title>
            <aug>
               <au>
                  <snm>Pollastri</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Przybylski</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Rost</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Baldi</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Proteins</source>
            <pubdate>2002</pubdate>
            <volume>47</volume>
            <fpage>228</fpage>
            <lpage>235</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/prot.10082</pubid>
                  <pubid idtype="pmpid" link="fulltext">11933069</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>The structure of the N-terminal region of murine skeletal muscle &#945;-dystroglycan discloses a modular architecture</p>
            </title>
            <aug>
               <au>
                  <snm>Bozic</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Sciandra</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lamba</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <fpage>44812</fpage>
            <lpage>44816</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.C400353200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15326183</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Identification of the &#946;-dystroglycan binding epitope within the C-terminal region of &#946;-dystroglycan</p>
            </title>
            <aug>
               <au>
                  <snm>Sciandra</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Schneider</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Giardina</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Baumgartner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Petrucci</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>2001</pubdate>
            <volume>268</volume>
            <fpage>4590</fpage>
            <lpage>4597</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1432-1327.2001.02386.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11502221</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Concerted mutation of Phe residues belonging to the &#946;-dystroglycan ectodomain strongly inhibits the interaction with &#945;-dystroglycan in vitro</p>
            </title>
            <aug>
               <au>
                  <snm>Bozzi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sciandra</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ferri</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Torreri</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Pavoni</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Petrucci</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Giardina</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>FEBS J</source>
            <pubdate>2006</pubdate>
            <volume>273</volume>
            <fpage>4929</fpage>
            <lpage>4943</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1742-4658.2006.05492.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17018058</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Localization of the dystrophin binding site at the carboxyl terminus of &#946;-dystroglycan</p>
            </title>
            <aug>
               <au>
                  <snm>Rosa</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ceccarini</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cavaldesi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zini</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Petrucci</snm>
                  <fnm>TC</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1996</pubdate>
            <volume>223</volume>
            <fpage>272</fpage>
            <lpage>277</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1996.0883</pubid>
                  <pubid idtype="pmpid" link="fulltext">8670271</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Gene loss and evolutionary rates following whole-genome duplication in teleost fishes</p>
            </title>
            <aug>
               <au>
                  <snm>Brunet</snm>
                  <fnm>FG</fnm>
               </au>
               <au>
                  <snm>Crollius</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Paris</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Aury</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Gibert</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Jaillon</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Laudet</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Robinson-Rechavi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2006</pubdate>
            <volume>23</volume>
            <fpage>1808</fpage>
            <lpage>1816</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msl049</pubid>
                  <pubid idtype="pmpid" link="fulltext">16809621</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Modeling human muscle disease in zebrafish</p>
            </title>
            <aug>
               <au>
                  <snm>Guyon</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Steffen</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Howell</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Pusack</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Lawrence</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kunkel</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>2007</pubdate>
            <volume>1772</volume>
            <fpage>205</fpage>
            <lpage>215</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16934958</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Agrin is a high-affinity binding protein of dystroglycan in non-muscle tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Gesemann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Schumacher</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Ruegg</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1998</pubdate>
            <volume>273</volume>
            <fpage>600</fpage>
            <lpage>605</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.273.1.600</pubid>
                  <pubid idtype="pmpid" link="fulltext">9417121</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>An agrin minigene rescues dystrophic symptoms in a mouse model for congenital muscular dystrophy</p>
            </title>
            <aug>
               <au>
                  <snm>Moll</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Barzaghi</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bezakova</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lochmuller</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Engvall</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Ruegg</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2001</pubdate>
            <volume>413</volume>
            <fpage>302</fpage>
            <lpage>307</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35095054</pubid>
                  <pubid idtype="pmpid" link="fulltext">11565031</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>LARGE2 facilitates the maturation of &#945;-dystroglycan more effectively than LARGE</p>
            </title>
            <aug>
               <au>
                  <snm>Fujimura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sawaki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sakai</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hiruma</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nakanishi</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sato</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohkura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Narimatsu</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2005</pubdate>
            <volume>329</volume>
            <fpage>1162</fpage>
            <lpage>1171</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2005.02.082</pubid>
                  <pubid idtype="pmpid" link="fulltext">15752776</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Characterization of the LARGE family of putative glycosyltransferases associated with dystroglycanopathies</p>
            </title>
            <aug>
               <au>
                  <snm>Grewal</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>McLaughlan</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Browning</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Hewitt</snm>
                  <fnm>JE</fnm>
               </au>
            </aug>
            <source>Glycobiology</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <fpage>912</fpage>
            <lpage>23</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/glycob/cwi094</pubid>
                  <pubid idtype="pmpid" link="fulltext">15958417</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1994</pubdate>
            <volume>22</volume>
            <fpage>4673</fpage>
            <lpage>4680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">308517</pubid>
                  <pubid idtype="pmpid" link="fulltext">7984417</pubid>
                  <pubid idtype="doi">10.1093/nar/22.22.4673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Prediction, conservation analysis, and structural characterization of mammalian mucin-type O-glycosylation sites</p>
            </title>
            <aug>
               <au>
                  <snm>Julenius</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Molgaard</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gupta</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Brunak</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Glycobiology</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <fpage>153</fpage>
            <lpage>164</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/glycob/cwh151</pubid>
                  <pubid idtype="pmpid" link="fulltext">15385431</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Immunodetection of partially glycosylated isoforms of &#945;-dystroglycan by a new monoclonal antibody against its &#946;-dystroglycan-binding epitope</p>
            </title>
            <aug>
               <au>
                  <snm>Pavoni</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Sciandra</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Barca</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Giardina</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Petrucci</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Brancaccio</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>2005</pubdate>
            <volume>579</volume>
            <fpage>493</fpage>
            <lpage>499</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.febslet.2004.10.111</pubid>
                  <pubid idtype="pmpid" link="fulltext">15642365</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
