<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2199-10-1</ui>
   <ji>1471-2199</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Identification of suitable internal control genes for expression studies in <it>Coffea arabica </it>under different experimental conditions</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Barsalobres-Cavallari</snm>
               <mi>F</mi>
               <fnm>Carla</fnm>
               <insr iid="I1"/>
               <email>barsalobres@gmail.com</email>
            </au>
            <au id="A2">
               <snm>Severino</snm>
               <mi>E</mi>
               <fnm>F&#225;bio</fnm>
               <insr iid="I1"/>
               <email>fabio.bjj@gmail.com</email>
            </au>
            <au id="A3">
               <snm>Maluf</snm>
               <mi>P</mi>
               <fnm>Mirian</fnm>
               <insr iid="I2"/>
               <email>maluf@iac.sp.gov.br</email>
            </au>
            <au id="A4">
               <snm>Maia</snm>
               <mi>G</mi>
               <fnm>Ivan</fnm>
               <insr iid="I1"/>
               <email>igmaia@ibb.unesp.br</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Laborat&#243;rio de Biotecnologia e Gen&#233;tica Molecular, Departamento de Gen&#233;tica, Instituto de Bioci&#234;ncias, UNESP, Distrito de Rubi&#227;o J&#250;nior s/n, 18618-000, Botucatu, S&#227;o Paulo, Brazil</p>
            </ins>
            <ins id="I2">
               <p>Embrapa/IAC, Centro de Caf&#233; Alcides Carvalho, Campinas, S&#227;o Paulo, Brazil</p>
            </ins>
         </insg>
         <source>BMC Molecular Biology</source>
         <issn>1471-2199</issn>
         <pubdate>2009</pubdate>
         <volume>10</volume>
         <issue>1</issue>
         <fpage>1</fpage>
         <url>http://www.biomedcentral.com/1471-2199/10/1</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19126214</pubid>
               <pubid idtype="doi">10.1186/1471-2199-10-1</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>16</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>06</day>
               <month>1</month>
               <year>2009</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>06</day>
               <month>1</month>
               <year>2009</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2009</year>
         <collab>Barsalobres-Cavallari et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Quantitative data from gene expression experiments are often normalized by transcription levels of reference or housekeeping genes. An inherent assumption for their use is that the expression of these genes is highly uniform in living organisms during various phases of development, in different cell types and under diverse environmental conditions. To date, the validation of reference genes in plants has received very little attention and suitable reference genes have not been defined for a great number of crop species including <it>Coffea arabica</it>. The aim of the research reported herein was to compare the relative expression of a set of potential reference genes across different types of tissue/organ samples of coffee. We also validated the expression profiles of the selected reference genes at various stages of development and under a specific biotic stress.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>The expression levels of five frequently used housekeeping genes (reference genes), namely <it>alcohol dehydrogenase </it>(<it>adh</it>), <it>14-3-3</it>, <it>polyubiquitin </it>(<it>poly</it>), <it>&#946;-actin </it>(<it>actin</it>) and <it>glyceraldehyde-3-phosphate dehydrogenase </it>(<it>gapdh</it>) was assessed by quantitative real-time RT-PCR over a set of five tissue/organ samples (root, stem, leaf, flower, and fruits) of <it>Coffea arabica </it>plants. In addition to these commonly used internal controls, three other genes encoding a cysteine proteinase (<it>cys</it>), a caffeine synthase (<it>ccs</it>) and the 60S ribosomal protein L7 (<it>rpl7</it>) were also tested. Their stability and suitability as reference genes were validated by geNorm, NormFinder and BestKeeper programs. The obtained results revealed significantly variable expression levels of all reference genes analyzed, with the exception of <it>gapdh</it>, which showed no significant changes in expression among the investigated experimental conditions.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our data suggests that the expression of housekeeping genes is not completely stable in coffee. Based on our results, <it>gapdh</it>, followed by <it>14-3-3 </it>and <it>rpl7 </it>were found to be homogeneously expressed and are therefore adequate for normalization purposes, showing equivalent transcript levels in different tissue/organ samples. <it>Gapdh </it>is therefore the recommended reference gene for measuring gene expression in <it>Coffea arabica</it>. Its use will enable more accurate and reliable normalization of tissue/organ-specific gene expression studies in this important cherry crop plant.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The study of biological regulations is very often correlated to quantification assays. In order to detect differential expression of a gene(s) in distinct biological samples, such as tissue types or under different experimental conditions, the invention of quantitative PCR (qPCR) has transformed the field of gene expression analysis in living organisms <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. In comparison to classical reverse transcription-polymerase chain reaction (RT-PCR), the main advantages of qPCR are higher sensitivity, specificity and broad quantification range of up to seven orders of magnitude <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. Regardless of being an extremely powerful technique, qPCR has its pitfalls, the most important one being the need of appropriate data normalization with a reference gene <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p>According to Andersen et al. <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, accurate data normalization is an absolute requirement for correct measurement of gene expression. Expression of the reference gene used to normalize qPCR analyses should be unaffected throughout many biological contexts; otherwise, it may lead to erroneous results <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. Until recently, several such genes (<it>&#946;-actin</it>, <it>rRNA</it>, <it>&#946;-tubulin</it>, <it>alcohol dehydrogenase</it>, <it>glyceraldehyde-3-phosphate dehydrogenase</it>, <it>14-3-3 </it>and <it>polyubiquitin</it>) have been used as internal controls for gene expression analyses under the assumption of stable expression <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. However, several reports have demonstrated that the expression levels of these so-called reference genes differ among different tissue/organ types <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B16">16</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. Consequently, these genes are unsuitable as transcriptional inner controls, and their use to normalize qPCR data in different tissues may induce significant experimental errors that could result in inappropriate biological data interpretation <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B14">14</abbr><abbr bid="B17">17</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>.</p>
         <p>Recognizing the importance of reference gene(s) in normalization of qPCR data, various housekeeping genes have been evaluated for stable expression under specific conditions in various organisms. In plants, only a few of them have been investigated in some detail in rice <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp>, poplar <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>, potato <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>, soybean <abbrgrp><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr></abbrgrp> and <it>Arabidopsis thaliana </it><abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. So far, suitable internal controls for gene expression studies have not been defined for <it>Coffea arabica</it>.</p>
         <p>Coffee is an agricultural crop of significant economic importance. <it>Coffea arabica </it>L. (arabica type coffee) is typical of the highland growing regions and is responsible for almost 75% of world production <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. In this study, we report the validation of housekeeping genes to identify the most suitable internal reference gene(s) for normalization of qPCR data obtained among five different tissues/organs (root, stem, leaf, flower, and fruits) of <it>C. arabica</it>. To further validate our results, we evaluated the expression levels of our best reference genes at different developmental stages of flowers and cherries and under a specific biotic stress. Following the current literature, five candidate reference genes, namely <it>alcohol dehydrogenase </it>(<it>adh</it>), <it>polyubiquitin </it>(<it>poly</it>), <it>14-3-3</it>, <it>&#946;-actin </it>(<it>actin</it>) and <it>glyceraldehyde-3-phosphate dehydrogenase </it>(<it>gapdh</it>), were selected. In addition to these commonly used internal controls, three other genes coding for a cysteine proteinase (<it>cys</it>), a caffeine synthase (<it>ccs</it>) and the 60S ribosomal protein L7 (<it>rpl7</it>), respectively, were included in this analysis. These potential reference genes were ranked according to their expression profiles and stability.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <p>The expression profile of eight candidate reference genes (<it>actin</it>, <it>adh</it>, <it>14-3-3</it>, <it>ccs</it>, <it>gapdh</it>, <it>poly</it>, <it>rpl7</it>, or <it>cys</it>) was firstly assessed by qPCR over a panel of five coffee tissue/organ samples (root, stem, leaf, flower, or fruit).</p>
         <sec>
            <st>
               <p>Descriptive analysis of the reference candidate genes</p>
            </st>
            <p>Descriptive statistics of the derived crossing points (CP), based on BestKeeper program <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, were calculated to investigate the variation level of each candidate gene following Pfaffl et al. <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. According to this analysis (see Table <tblr tid="T1">1</tblr>), the gene with lowest expression level was <it>actin</it>, for which CP values were obtained around cycles 31&#8211;34; while the highest was <it>gapdh</it>, whose CP values were obtained around cycles 21&#8211;23. The expression levels of <it>14-3-3</it>, <it>ccs</it>, <it>gapdh</it>, and <it>rpl7 </it>presented fluctuations of approximately &#177; 0.6 x-fold (0.52 x-fold &lt; SD &lt; 0.82 x-fold), whereas <it>poly </it>expression showed higher ranges of CP variation (SD = &#177; 1.39 cycles) as well as up- down-regulation (&#177; 2.09 x-fold). The coefficient of variation (CV) of the assay was 3.57% (total essay variability), which is within the range (from 3.4% to 11.6%) of previously reported values for qPCR <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Descriptive statistics and expression level analyses of the tested candidate reference genes based on their crossing point (CP) values</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c ca="left">
                        <p>Factor</p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>actin</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>adh</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>14-3-3</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>ccs</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>gapdh</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>poly</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>rpl7</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>cys</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>GM [CP]</p>
                     </c>
                     <c ca="center">
                        <p>32.72</p>
                     </c>
                     <c ca="center">
                        <p>29.7</p>
                     </c>
                     <c ca="center">
                        <p>29.63</p>
                     </c>
                     <c ca="center">
                        <p>26.67</p>
                     </c>
                     <c ca="center">
                        <p>22.86</p>
                     </c>
                     <c ca="center">
                        <p>28.46</p>
                     </c>
                     <c ca="center">
                        <p>30.76</p>
                     </c>
                     <c ca="center">
                        <p>26.67</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AM [CP]</p>
                     </c>
                     <c ca="center">
                        <p>32.74</p>
                     </c>
                     <c ca="center">
                        <p>29.71</p>
                     </c>
                     <c ca="center">
                        <p>29.64</p>
                     </c>
                     <c ca="center">
                        <p>26.67</p>
                     </c>
                     <c ca="center">
                        <p>22.88</p>
                     </c>
                     <c ca="center">
                        <p>28.49</p>
                     </c>
                     <c ca="center">
                        <p>30.77</p>
                     </c>
                     <c ca="center">
                        <p>26.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Min [CP]</p>
                     </c>
                     <c ca="center">
                        <p>31.4</p>
                     </c>
                     <c ca="center">
                        <p>28.64</p>
                     </c>
                     <c ca="center">
                        <p>28.94</p>
                     </c>
                     <c ca="center">
                        <p>25.92</p>
                     </c>
                     <c ca="center">
                        <p>21.74</p>
                     </c>
                     <c ca="center">
                        <p>26.79</p>
                     </c>
                     <c ca="center">
                        <p>30.13</p>
                     </c>
                     <c ca="center">
                        <p>25.24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Max [CP]</p>
                     </c>
                     <c ca="center">
                        <p>34.35</p>
                     </c>
                     <c ca="center">
                        <p>31.12</p>
                     </c>
                     <c ca="center">
                        <p>31.21</p>
                     </c>
                     <c ca="center">
                        <p>27.37</p>
                     </c>
                     <c ca="center">
                        <p>23.77</p>
                     </c>
                     <c ca="center">
                        <p>30.07</p>
                     </c>
                     <c ca="center">
                        <p>31.93</p>
                     </c>
                     <c ca="center">
                        <p>28.44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SD [&#177; CP]</p>
                     </c>
                     <c ca="center">
                        <p>1.23</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.92</p>
                     </c>
                     <c ca="center">
                        <p>0.58</p>
                     </c>
                     <c ca="center">
                        <p>0.94</p>
                     </c>
                     <c ca="center">
                        <p>1.39</p>
                     </c>
                     <c ca="center">
                        <p>0.69</p>
                     </c>
                     <c ca="center">
                        <p>1.31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CV [%CP]</p>
                     </c>
                     <c ca="center">
                        <p>3.75</p>
                     </c>
                     <c ca="center">
                        <p>3.35</p>
                     </c>
                     <c ca="center">
                        <p>3.09</p>
                     </c>
                     <c ca="center">
                        <p>2.19</p>
                     </c>
                     <c ca="center">
                        <p>4.12</p>
                     </c>
                     <c ca="center">
                        <p>4.89</p>
                     </c>
                     <c ca="center">
                        <p>2.24</p>
                     </c>
                     <c ca="center">
                        <p>4.89</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Min [x-fold]</p>
                     </c>
                     <c ca="center">
                        <p>0.41</p>
                     </c>
                     <c ca="center">
                        <p>0.43</p>
                     </c>
                     <c ca="center">
                        <p>0.66</p>
                     </c>
                     <c ca="center">
                        <p>0.53</p>
                     </c>
                     <c ca="center">
                        <p>0.54</p>
                     </c>
                     <c ca="center">
                        <p>0.18</p>
                     </c>
                     <c ca="center">
                        <p>0.68</p>
                     </c>
                     <c ca="center">
                        <p>0.41</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Max [x-fold]</p>
                     </c>
                     <c ca="center">
                        <p>3.04</p>
                     </c>
                     <c ca="center">
                        <p>3.1</p>
                     </c>
                     <c ca="center">
                        <p>2.62</p>
                     </c>
                     <c ca="center">
                        <p>1.83</p>
                     </c>
                     <c ca="center">
                        <p>1.64</p>
                     </c>
                     <c ca="center">
                        <p>5.22</p>
                     </c>
                     <c ca="center">
                        <p>2.02</p>
                     </c>
                     <c ca="center">
                        <p>3.04</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SD [&#177; x-fold]</p>
                     </c>
                     <c ca="center">
                        <p>1.07</p>
                     </c>
                     <c ca="center">
                        <p>1.08</p>
                     </c>
                     <c ca="center">
                        <p>0.82</p>
                     </c>
                     <c ca="center">
                        <p>0.52</p>
                     </c>
                     <c ca="center">
                        <p>0.52</p>
                     </c>
                     <c ca="center">
                        <p>2.09</p>
                     </c>
                     <c ca="center">
                        <p>0.53</p>
                     </c>
                     <c ca="center">
                        <p>1.08</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Abbreviations: N: number of samples; CP: crossing-point; GM [CP]: geometric CP mean; AM [CP]: arithmetic CP mean; Min [CP] and Max [CP]: CP threshold values; SD [&#177; CP]: CP standard deviation; CV [%CP]: variance coefficient expressed as percentage of CP level; Min [x-fold] and Max [x-fold]: threshold expression levels expressed as absolute x-fold over- or under-regulation coefficient; SD [&#177; x-fold]: standard deviation of absolute regulation coefficient.</p>
               </tblfn>
            </tbl>
            <p>Descriptive statistics for the expression analyses of each reference candidate gene in the five distinct coffee plant tissue/organ types was also obtained (see Additional File <supplr sid="S1">1</supplr>). According to this analysis, the gene that exhibit the minor gene expression variation among the analyzed tissues was <it>gapdh </it>[SD (&#177; x-fold) = 0.04], while the gene with major variation was <it>ccs </it>[SD (&#177; x-fold) = 0.59]. In addition, <it>ccs </it>also presented the highest expression variation in flowers and fruits tissue samples, and therefore it cannot be used as a reference gene. Numerous studies have shown that the expression of housekeeping genes can vary under given situations <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. This may partly be explained by the fact that housekeeping genes are not only implicated in the basal cell metabolism but also participate in other cellular functions <abbrgrp><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Results from Bestkeeper descriptive statistical analysis</b>. The data provided represent the descriptive statistics, based on crossing point (CP) values, for the expression analyses of the candidate reference genes in the five distinct coffee plant tissue/organ set.</p>
               </text>
               <file name="1471-2199-10-1-S1.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>A model-based approach for estimation of expression variation</p>
            </st>
            <p>The model-based variance estimation approach, a Visual Basic application for Microsoft Excel (termed NormFinder) <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B49">49</abbr></abbrgrp>, was used to evaluate expression stability of reference candidate genes. This analysis allowed the ranking of candidate genes since the estimated variation directly indicates the introduced error associated with their use. According to this method, the gene with minimal estimated intra- and intertissue variation was <it>gapdh </it>(expression stability = 0.071) while the gene with the maximal variation was <it>poly </it>(expression stability = 0.592) (see Figure <figr fid="F1">1</figr>), thus corroborating the results obtained in descriptive analysis.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Stability of the investigated candidate reference genes</p>
               </caption>
               <text>
                  <p><b>Stability of the investigated candidate reference genes</b>. Stability values of the eight candidate reference genes according to the model-based approach. A lower value of average expression stability indicates more stable expression.</p>
               </text>
               <graphic file="1471-2199-10-1-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Ranking the candidate reference genes</p>
            </st>
            <p>The relationship between the stability value and the intra- and intertissue expression variations is present in Figure <figr fid="F2">2</figr>. This figure clearly demonstrates the distinct specificities of the investigated genes. According to this analysis, the best candidate gene should present the minimal combined inter- and intra-tissue expression variation. Consistent with the descriptive analysis (see Table <tblr tid="T1">1</tblr> and Additional File <supplr sid="S1">1</supplr>) and the model-based variance estimation approach (see Figure <figr fid="F1">1</figr>), <it>gapdh </it>showed not only the highest expression levels but was also the most stable gene studied. In Figure <figr fid="F2">2</figr>, it can be observed that almost all genes presented average of log expression levels near 0 (the thick dashed line). Log difference >0 (as observed for <it>actin</it>) or &lt;0 (as observed for <it>poly</it>) implies that variability in expression levels is significant, so the gene could be incorrectly used as reference gene for normalization. In this context, the <it>poly </it>gene presents the highest intertissue expression variation (SD = &#177; 0.65; see Figure <figr fid="F2">2</figr>). Thus, among the tested genes, <it>gapdh</it>, followed by <it>rpl7 </it>and <it>14-3-3</it>, showed the most stable expression over the investigated panel of five distinct coffee tissue/organ types.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Gene expression differences among the candidate reference genes</p>
               </caption>
               <text>
                  <p><b>Gene expression differences among the candidate reference genes</b>. The log-transformed gene expression levels are represented by black circles. The intertissue variation is indicated by vertical bars that give a confidence interval for the difference. The two thin dashed lines represent the maximal standard deviation of the reference candidate genes, with a log expression levels difference between 0.5 and -0.5.</p>
               </text>
               <graphic file="1471-2199-10-1-2"/>
            </fig>
            <p>The candidate genes were also ranked according to their M values using the geNorm program. The average expression stabilities (M values) of all tested genes were lower than 1.5, with <it>14-3-3 </it>and <it>actin </it>showing the most stable expression (data not shown). Although <it>actin </it>gene has shown highest stability following geNorm analysis, this gene presented the lowest expression profile according the BestKeeper analysis. Corroborating the previous analysis, <it>poly </it>remained the least stable gene.</p>
            <p>As a whole, our analysis indicates that housekeeping genes are differently regulated in different tissues/organs of coffee plants and may exhibit variable expression patterns. The observed differences in gene expression ratios along a comprehensive panel of tissues/organs are consistent with the data presented by Barber et al. <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, Iskandar et al. <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> and Jain et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Our results also provide evidences that normalizations to the expression level of a single gene in samples from distinct tissue types may induce to errors, thus corroborating previous studies <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B51">51</abbr><abbr bid="B52">52</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Comparison of the identified best reference genes to published data</p>
            </st>
            <p>In order to validate our potential candidate reference genes (<it>gapdh</it>, <it>rpl7 </it>and <it>14-3-3</it>), the expression stability of these genes under the influence of a specific biotic stress was investigated. In this case, the obtained results were compared to those dealing with similar coffee gene expression analysis but using <it>ubiquitin </it>as a reference gene for normalization <abbrgrp><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr><abbr bid="B56">56</abbr></abbrgrp>.</p>
            <p>The comparison was conduced by linear regressions analyzes of the CP difference (&#916;CP) obtained from the assayed expression levels of the tested genes in leaves of <it>C. arabica </it>inoculated, or not (control plants), with <it>Hemileia vastatrix</it>. The average CP (<it>N </it>= 3) was calculated for each gene and the &#916;CP (CP<sub>inoculated leaf </sub>- CP<sub>non-inoculated leaf</sub>) was determined for each time-point (8, 12 and 24 h after fungus inoculation).</p>
            <p>As it can be observed in Figure <figr fid="F3">3</figr>, the regression lines for <it>14-3-3 </it>and <it>gapdh </it>have slopes close to zero (<it>14-3-3 </it>= 0.085; <it>gapdh </it>= 0.18), indicating similar expression levels in inoculated and non-inoculated leaves, and reinforcing their use as effective normalization genes <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B57">57</abbr><abbr bid="B58">58</abbr></abbrgrp>. In contrast, the slope value for <it>rpl7 </it>was significantly different from zero and higher than the one obtained for <it>ubiquitin </it>(<it>ubiquitin </it>= 0.2467; <it>rpl7 </it>= 0.5389), thus limiting its use as a normalization factor under biotic stress condition.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Evaluation of the expression of selected reference genes during fungus infection</p>
               </caption>
               <text>
                  <p><b>Evaluation of the expression of selected reference genes during fungus infection</b>. The expression of selected reference genes (<it>gapdh</it>, <it>rpl7 </it>and <it>14-3-3</it>) and of a commonly used coffee normalization gene (<it>ubiquitin</it>) was monitored in leaves of <it>C. arabica </it>var. Mundo Novo inoculated with <it>Hemileia vastatrix</it>. The crossing point (CP) difference (&#916;CP = CP<sub>inoculated leaf </sub>- CP<sub>non-inoculated leaf</sub>) was calculated for each time-point (8, 12 and 24 h after challenge by the rust fungus) to investigate the expression levels of each reference gene. The standard error of the triplicates for each time-point is indicated by horizontal bars.</p>
               </text>
               <graphic file="1471-2199-10-1-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Validation of data results in different developmental stages of flowers and coffee cherries</p>
            </st>
            <p>An additional validation step of the expression levels of <it>gapdh</it>, <it>14-3-3</it>, <it>rpl7 </it>and <it>ubiquitin </it>was performed using unpooled tissue samples from flower and cherry developmental series. The employed sample set is given in the Additional File <supplr sid="S2">2</supplr>.</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Coffee tissue/organ sample set (</b><it><b>Coffea arabica </b></it><b>var. Mundo Novo &#8211; IAC 388-17-1) used in the present study</b>. Freshly harvested roots, stems, and leaves were obtained from 4 month-old coffee plants grown under greenhouse conditions (28&#176;C, 60% RH) in Campinas, S&#227;o Paulo, Brazil. Flower and fruit samples, at different developmental stages, were collected from 4&#8211;5 year-old field grown plants in Botucatu and in Campinas, S&#227;o Paulo, Brazil. After harvesting, fresh tissue samples were frozen immediately in liquid nitrogen until RNA extraction.</p>
               </text>
               <file name="1471-2199-10-1-S2.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>In this assay, the highly expressed gene was <it>gapdh </it>(<inline-formula><m:math name="1471-2199-10-1-i1" xmlns:m="http://www.w3.org/1998/Math/MathML"><m:semantics><m:mrow><m:mover accent="true"><m:mrow><m:mtext>CP</m:mtext></m:mrow><m:mo stretchy="true">&#175;</m:mo></m:mover></m:mrow><m:annotation encoding="MathType-MTEF">
 MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaWaa0aaaeaacqqGdbWqcqqGqbauaaaaaa@2E1A@</m:annotation></m:semantics></m:math></inline-formula> = 21 cycles) followed by <it>ubiquitin </it>(<inline-formula><m:math name="1471-2199-10-1-i1" xmlns:m="http://www.w3.org/1998/Math/MathML"><m:semantics><m:mrow><m:mover accent="true"><m:mrow><m:mtext>CP</m:mtext></m:mrow><m:mo stretchy="true">&#175;</m:mo></m:mover></m:mrow><m:annotation encoding="MathType-MTEF">
 MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaWaa0aaaeaacqqGdbWqcqqGqbauaaaaaa@2E1A@</m:annotation></m:semantics></m:math></inline-formula> = 24 cycles), while <it>14-3-3 </it>and <it>rpl7 </it>presented the same mean CP (25 cycles). The comparison of gene contributions is present in Figure <figr fid="F4">4</figr>. As already observed, <it>gapdh </it>showed the greatest stability in expression among all coffee tissue/organ samples analyzed, while expression of <it>rpl7 </it>and <it>14-3-3 </it>varied the most, especially in flowers at stage 1 of development (see Figure <figr fid="F4">4</figr> and Additional File <supplr sid="S2">2</supplr>). As mentioned earlier, <it>ubiquitin </it>was used as a standard reference gene for comparison.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Validation of the selected reference genes in samples from flowers and cherries at different developmental stages</p>
               </caption>
               <text>
                  <p><b>Validation of the selected reference genes in samples from flowers and cherries at different developmental stages</b>. Comparison of gene contributions, by mean amplification crossing points (CP) represented in percentage, in each coffee tissue/organ type. The investigated tissue/organ sample set was: root, stem, leaf, three different stages of flower development (FW 1, FW 3 and FW 5) and five different kinds of coffee cherries (FR 1, FR 2, FR 3, FR 4 and FR 5).</p>
               </text>
               <graphic file="1471-2199-10-1-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>General remarks about the selected reference genes</p>
            </st>
            <p>According to these results, the gene encoding glyceraldeyde-3-phosphate dehydrogenase (GAPDH), an enzyme of glycolysis <abbrgrp><abbr bid="B59">59</abbr></abbrgrp>, outperformed all other reference genes tested and should therefore be considered a suitable reference gene for expression studies in arabica coffee plants. This observation corroborates the quantification of <it>gapdh </it>expression in different tissues of sugarcane <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> and <it>Eucalyptus </it><abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. In contrast, several reports in human and animal systems have suggested that this reference gene has limitations for its use as internal control due to its marked variability of expression among tissue types <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B16">16</abbr><abbr bid="B51">51</abbr><abbr bid="B60">60</abbr></abbrgrp>.</p>
            <p>The assayed <it>14-3-3 </it>gene also showed a stable expression (see Figure <figr fid="F2">2</figr>) that was supported by the descriptive analysis (see Table <tblr tid="T1">1</tblr> and also Additional File <supplr sid="S1">1</supplr>) and confirmed in the biotic stress assay (see Figure <figr fid="F3">3</figr>). However, its expression presented some variation among different stages of coffee flower development (see Figure <figr fid="F4">4</figr>). Papini-Terzi et al. <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> recommended <it>14-3-3 </it>as a suitable reference gene for expression normalization in a wide range of tissue samples of sugarcane.</p>
            <p>The gene encoding the transcription regulator and structural constituent of the 60S subunit of the cytosolic ribosome (<it>rpl7</it>) could also be used as an internal control in gene expression studies in <it>C. arabica</it>, due to its stability (see Figure <figr fid="F2">2</figr>) and acceptable variation among tissue/organ types (see Table <tblr tid="T1">1</tblr>). Our results are in agreement with previous published data for this gene since small variation among tissue types was detected by descriptive analysis (see Additional File <supplr sid="S1">1</supplr>). Nevertheless, in leaves of <it>C. arabica </it>inoculated with <it>H. vastatrix</it>, it was observed that the expression ratio of <it>rpl7 </it>(expressed by &#916;CP) was not constant and the absolute value of <it>rpl7 </it>linear regression slope was superior to that observed for a commonly used coffee normalization gene (<it>ubiquitin</it>) (see Figure <figr fid="F3">3</figr>). In addition, this gene, like <it>14-3-3</it>, presented a variable expression level among different stages of coffee flower development (see Figure <figr fid="F4">4</figr>). In sugarcane, the relative expression of <it>rpl35-4</it>, a gene coding for the ribosomal L35-4 60S protein, was also reported to be stable <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. These authors estimated the sugarcane leaf transcriptome using Serial Analysis of Gene Expression (SAGE) and reported that tag associated with the <it>rpl35-4 </it>transcript presented minimum variation among the analyzed SAGE libraries.</p>
            <p>The remaining tested genes showed to be unsuitable as internal controls for normalization purposes in <it>C. arabica</it>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>This study provides the most extensive collection of arabica coffee tissue/organ mRNA expression data for eight reference candidate genes. Our analysis evidenced stable levels of <it>gapdh</it>, <it>14-3-3 </it>and <it>rpl7 </it>mRNA in different <it>Coffea arabica </it>tissue/organ types. Consequently, these genes can be used for accurate and reliable normalization in future gene expression studies in coffee (e.g., they can be used as a reference for a target gene in a specific tissue or experimental condition). In this respect, we suggest <it>gapdh </it>as the most relevant reference gene for accurate normalization purposes in <it>C. arabica</it>, showing almost constant expression levels in the investigated experimental set-up.</p>
         <p>Moreover, we have shown that depending on the reference inner control gene, the within-tissue variation of mRNA expression levels is generally small, whereas among tissues/organs the variation can be substantial. This indicates that normalizations to a single gene across different tissue types are unwise. Since the variation observed between normal tissues of different types may in part be due to the different metabolic demands of those tissues, comparisons within a tissue type between normal and diseased states are similarly unwise.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Plant material and growth conditions</p>
            </st>
            <p>Freshly harvested roots, stems, and leaves were obtained from ten 4 month-old coffee plants (<it>Coffea arabica </it>var. Mundo Novo IAC 388-17-1) grown under greenhouse conditions (28&#176;C, 60% RH) in Campinas, S&#227;o Paulo, Brazil. Flower and fruit samples, at different developmental stages, were collected from 4&#8211;5 year-old plants of var. Mundo Novo grown under field conditions at Botucatu and Campinas, S&#227;o Paulo, Brazil (see Additional File <supplr sid="S2">2</supplr>). After harvesting, fresh tissue samples were frozen immediately in liquid nitrogen until RNA extraction.</p>
         </sec>
         <sec>
            <st>
               <p>Biotic stress assay</p>
            </st>
            <p>For the biotic stress assay, equally-aged sets of <it>Coffea arabica </it>var. Mundo Novo plants were kept in growth chamber (16 h/8 h light/dark; 23&#176;C; 70% RH) for at least one week, before being inoculated with the coffee leaf-rust fungus <it>Hemileia vastatrix </it>Berk and Br. race II, that elicits a compatible reaction in coffee. The urediniospores (100 mg) were harvested in a <it>C. arabica </it>field in Campinas, S&#227;o Paulo, Brazil, and diluted in 10 ml of sterile water under dark conditions.</p>
            <p>Leaves from the second pair of plagiotropic shoots from the apex of 4 month-old coffee plants were inoculated with an aqueous suspension of fresh urediniospores (10 mg/ml). To allow spore germination, the inoculated leaves were covered with a wet black plastic film for 24 h. Inoculated leaves were not detached from the plants. Mock-inoculated controls as well as non-inoculated controls were performed. The biological samples were obtained from three independent experiments.</p>
            <p>Leaves were randomly sampled at different time-points after inoculation: 0, 8, 12, and 24 h, and immediately deep-frozen. To confirm the infection by the leaf-rust fungus, some inoculated leaves were maintained in plants.</p>
         </sec>
         <sec>
            <st>
               <p>RNA isolation and quality controls</p>
            </st>
            <p>Tissue samples of 2.0 to 2.5 mg were weighed and ground to fine powder in liquid nitrogen using a pre-cooled mortar and pestle. Total RNA from the majority of the samples was extracted using TRIzol reagent (Invitrogen) according to manufacturer's instructions. Alternatively, total RNA from seeds was isolated by lithium chloride (LiCl) method, according to Mason and Schmidt <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. Only RNA samples with 260/280 ratio between 1.9 and 2.1 and 260/230 ratio greater than 2.0 were used for subsequent analyses. The integrity of the RNA samples was also assessed on 1.0% agarose/formaldehyde gel electrophoresis.</p>
         </sec>
         <sec>
            <st>
               <p>Reverse transcription</p>
            </st>
            <p>Five micrograms of total RNA were treated with DNAse I (Promega) and an aliquot of 500 ng of the treated RNA was reverse-transcribed using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Both were used following the manufacturer's instructions. The cDNA sample concentration was determined using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies).</p>
         </sec>
         <sec>
            <st>
               <p>Primer design</p>
            </st>
            <p>Primers were designed for <it>Coffea </it>orthologs of commonly used housekeeping genes representing distinct functional classes, identified by BLAST searches in the Brazilian Coffee EST database <abbrgrp><abbr bid="B63">63</abbr><abbr bid="B64">64</abbr></abbrgrp> as well as in the public coffee EST database (at the SOL site hosted by Cornell University <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>). For primer design, the Primer Express 2.0 software (PE Applied Biosystems, USA) with default parameters was employed. The accession numbers, gene description, primers sequences and amplicon lengths are shown in Table <tblr tid="T2">2</tblr>. All primer pairs produced a single product and amplified the target transcript with equal efficiency over a 1000-fold range of input material.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Candidate reference genes and primer sequences used for quantitative PCR analysis</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>Gene name</p>
                     </c>
                     <c ca="left">
                        <p>Source gene <sup>a</sup></p>
                     </c>
                     <c ca="left">
                        <p>Gene description</p>
                     </c>
                     <c ca="left">
                        <p>Primer sequence <sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Amplicon length (bp)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>poly</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U347154</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>hexameric polyubiquitin</p>
                     </c>
                     <c ca="left">
                        <p>5' CGCTGACTACAATATCCAAAAGGA 3'</p>
                     </c>
                     <c ca="center">
                        <p>67</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' CTGCATTCCACCCCTCAGA 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>adh</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U350348</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>alcohol dehydrogenase class III</p>
                     </c>
                     <c ca="left">
                        <p>5' CCTCAAGCCGGCGAAGT 3'</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' CTGTATGGCAGAGGGCAGTGT 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>actin</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U353034</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>actin 7</p>
                     </c>
                     <c ca="left">
                        <p>5' AATTGTCCGTGACATCAAGGAA 3'</p>
                     </c>
                     <c ca="center">
                        <p>82</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' TGAGCTGCTCTTGGCTGTTTC 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>gapdh</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U347734</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>glyceraldehyde-3-phosphate dehydrogenase</p>
                     </c>
                     <c ca="left">
                        <p>5' TTGAAGGGCGGTGCAAA 3'</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' AACATGGGTGCATCCTTGCT 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>rpl7</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U351477</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>60S ribosomal protein L7</p>
                     </c>
                     <c ca="left">
                        <p>5' CATTCGAGGTATCAATGCTATGCA 3'</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' TGTCTCAGGCGCAGAAGCT 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ccs</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U350284</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>caffeine synthase 1</p>
                     </c>
                     <c ca="left">
                        <p>5' CAATGCCCGGCTCTTTCTAC 3'</p>
                     </c>
                     <c ca="center">
                        <p>68</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' GTAACAAGAGTGTAAAAAATGCATGGA 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>cys</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U352616</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>cysteine proteinase</p>
                     </c>
                     <c ca="left">
                        <p>5' GCGATCGCTACCGTCCAA 3'</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' CTTTTTCTCTCCAGTCAATGGAGTT 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>14-3-3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SGN-U356404</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>14-3-3 protein</p>
                     </c>
                     <c ca="left">
                        <p>5' TGTGCTCTTTAGCTTCCAAACG 3'</p>
                     </c>
                     <c ca="center">
                        <p>75</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5' CTTCACGAGACATATTGTCTTACTCAAA 3'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a </sup>Unigene accession number according to the SOL Genomics Network <abbrgrp><abbr bid="B65">65</abbr></abbrgrp></p>
                  <p><sup>b </sup>Forward (upper line) and reverse (lower line) primer sequences</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Quantitative PCR</p>
            </st>
            <p>The PCR mixture contained 5 &#956;l of a 1:10 dilution of the synthesized cDNA, primers to a final concentration of 700 nM each, 17.5 &#956;l of the SYBR Green PCR Master Mix (Applied Biosystems, USA) and PCR-grade water up to a total volume of 35 &#956;l. The mixes were homogenized and split in three samples of 10 &#956;l, thus each gene reaction was performed in triplicate. PCR reactions in the absence of template were also performed as negative controls for each primer pair. An equimolar pool of cDNA samples of five coffee tissue/organ types (root, stem, leaf, flower, and fruit) was prepared to be used as a common reference for all qPCR. The quantitative PCRs were performed employing the ABI Prism 7300 Sequence Detection System (PE Applied Biosystems, USA). All PCR reactions were performed under the following conditions: 2 min at 50&#176;C, 10 min at 95&#176;C, and 45 cycles of 15 s at 95&#176;C and 1 min at 65&#176;C in 96-well optical reaction plates (Applied Biosystems, USA). Confirmation of amplicon specificity was based on the dissociation curve at the end of each run and by product visualization after electrophoresis on an 8% polyacrylamide gel.</p>
         </sec>
         <sec>
            <st>
               <p>Analysis of candidate reference genes</p>
            </st>
            <p>To estimate the expression variation level of the eight candidate genes (<it>actin</it>, <it>adh</it>, <it>ccs</it>, <it>14-3-3</it>, <it>gapdh</it>, <it>poly</it>, <it>rpl7</it>, or <it>cys</it>) over a five coffee tissue/organ sample set (root, stem, leaf, flower, or fruit), the BestKeeper descriptive statistical method <abbrgrp><abbr bid="B45">45</abbr><abbr bid="B66">66</abbr></abbrgrp> was applied.</p>
            <p>To access the levels of gene expression for each gene in the different coffee tissue types, the method described by Ramakers et al. <abbrgrp><abbr bid="B67">67</abbr></abbrgrp> with modifications was used. Optic data were exported from 7300 Real-Time PCR System (PE Applied Biosystems, USA) into MS Excel. Four cycles at the exponential phase, near and including the crossing point (CP), were used. The fluorescence data were logarithmically transformed, and pasted into statistical software package (SAS version 8e, SAS Institute, Cary, NC, USA) for linear regression analysis, including determination of intercepts, slopes (x), PCR efficiency (<it>E </it>= 10<sup>slope</sup>) and their respective standard errors and correlation coefficients (R<sup>2</sup>). The gene expression values (x-fold) were obtained according to a mathematical model proposed by Pfaffl <abbrgrp><abbr bid="B68">68</abbr></abbrgrp>: x-fold = <it>E</it><sub>reference gene </sub><sup>&#916;CP</sup>, where &#916;CP = CP<sub>pool of tissues </sub>- CP<sub>tissue sample</sub>.</p>
            <p>Knowing the expression levels, the stability value was assessed utilizing NormFinder <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B49">49</abbr></abbrgrp> and geNorm <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B69">69</abbr></abbrgrp> programs.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>qPCR: Quantitative PCR; <it>poly</it>: hexameric polyubiquitin; <it>adh</it>: alcohol dehydrogenase class III; <it>actin</it>: actin 7; <it>rpl7</it>: 60S ribosomal protein L7; <it>ccs</it>: caffeine synthase 1; <it>gapdh</it>: glyceraldehyde-3-phosphate dehydrogenase; <it>cys</it>: cysteine proteinase; CP: crossing point.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>CFB-C and IGM conceived and designed this study. FES performed the biological assays. CFB-C and FES carried out the molecular genetic studies, participated in the qPCR experiments (acquisition, analysis and interpretation of data). MPM and IGM contributed with reagents/materials/analysis tools. IGM coordinated the study. CFB-C wrote the manuscript. All authors contributed, read, corrected and approved the final manuscript. The authors declare no conflict of interest in this work.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The authors thank Adalgisa Soares de Oliveira, Carla Cristina da Silva and Marcos Brandalise (EMBRAPA/IAC) for providing part of the plant materials used in this study. CFB-C was recipient of a fellowship from Conselho Nacional de Desenvolvimento Cient&#237;fico e Tecnol&#243;gico (CNPq), Brazil. FES was recipient of a fellowship from Coordena&#231;&#227;o de Aperfei&#231;oamento de Pessoal de N&#237;vel Superior (CAPES), Brazil. This research was sponsored by Cons&#243;rcio Brasileiro de Pesquisa e Desenvolvimento do Caf&#233; (CBP&amp;D-Caf&#233;), Empresa Brasileira de Pesquisa Agropecu&#225;ria (EMBRAPA) and Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo (FAPESP).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues</p>
            </title>
            <aug>
               <au>
                  <snm>Barber</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Harmer</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Coleman</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>BJ</fnm>
               </au>
            </aug>
            <source>Physiol Genomics</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <issue>3</issue>
            <fpage>389</fpage>
            <lpage>395</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1152/physiolgenomics.00025.2005</pubid>
                  <pubid idtype="pmpid" link="fulltext">15769908</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Real-time PCR: what relevance to plant studies?</p>
            </title>
            <aug>
               <au>
                  <snm>Gachon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Mingam</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Charrier</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>J Exp Bot</source>
            <pubdate>2004</pubdate>
            <volume>55</volume>
            <issue>402</issue>
            <fpage>1445</fpage>
            <lpage>1454</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jxb/erh181</pubid>
                  <pubid idtype="pmpid" link="fulltext">15208338</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Real-time, fluorescence-based quantitative PCR: a snapshot of current procedures and preferences</p>
            </title>
            <aug>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>Expert Rev Mol Diagn</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <issue>4</issue>
            <fpage>493</fpage>
            <lpage>498</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1586/14737159.5.4.493</pubid>
                  <pubid idtype="pmpid" link="fulltext">16013967</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream</p>
            </title>
            <aug>
               <au>
                  <snm>Ginzinger</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Exp Hematol</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <issue>6</issue>
            <fpage>503</fpage>
            <lpage>512</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0301-472X(02)00806-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12063017</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The real-time polymerase chain reaction</p>
            </title>
            <aug>
               <au>
                  <snm>Kubista</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Andrade</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Bengtsson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Forootan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jonak</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lind</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sindelka</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sjoback</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sjogreen</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Strombom</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Mol Aspects Med</source>
            <pubdate>2006</pubdate>
            <volume>27</volume>
            <fpage>95</fpage>
            <lpage>125</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.mam.2005.12.007</pubid>
                  <pubid idtype="pmpid" link="fulltext">16460794</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction</p>
            </title>
            <aug>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Nolan</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Biomol Tech</source>
            <pubdate>2004</pubdate>
            <volume>15</volume>
            <issue>3</issue>
            <fpage>155</fpage>
            <lpage>166</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2291693</pubid>
                  <pubid idtype="pmpid">15331581</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems</p>
            </title>
            <aug>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>J Mol Endocrinol</source>
            <pubdate>2002</pubdate>
            <volume>29</volume>
            <fpage>23</fpage>
            <lpage>39</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1677/jme.0.0290023</pubid>
                  <pubid idtype="pmpid" link="fulltext">12200227</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets</p>
            </title>
            <aug>
               <au>
                  <snm>Andersen</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Jensen</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Orntoft</snm>
                  <fnm>TF</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>64</volume>
            <issue>15</issue>
            <fpage>5245</fpage>
            <lpage>5250</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-04-0496</pubid>
                  <pubid idtype="pmpid" link="fulltext">15289330</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Real-time RT-PCR normalisation; strategies and considerations</p>
            </title>
            <aug>
               <au>
                  <snm>Huggett</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dheda</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bustin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zumla</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <issue>4</issue>
            <fpage>279</fpage>
            <lpage>284</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364190</pubid>
                  <pubid idtype="pmpid" link="fulltext">15815687</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Schmittgen</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>Zakrajsek</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>J Biochem Biophys Methods</source>
            <pubdate>2000</pubdate>
            <volume>46</volume>
            <issue>1&#8211;2</issue>
            <fpage>69</fpage>
            <lpage>81</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0165-022X(00)00129-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">11086195</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Validation of endogenous controls for gene expression studies in human adipocytes and preadipocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Gorzelniak</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Janke</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Engeli</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sharma</snm>
                  <fnm>AM</fnm>
               </au>
            </aug>
            <source>Horm Metab Res</source>
            <pubdate>2001</pubdate>
            <volume>33</volume>
            <issue>10</issue>
            <fpage>625</fpage>
            <lpage>627</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1055/s-2001-17911</pubid>
                  <pubid idtype="pmpid">11607884</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Impact of formalin-fixation and paraffin-embedding on the ratio between mRNA copy numbers of differently expressed genes</p>
            </title>
            <aug>
               <au>
                  <snm>von Smolinski</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Leverkoehne</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>von Samson-Himmelstjerna</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gruber</snm>
                  <fnm>AD</fnm>
               </au>
            </aug>
            <source>Histochem Cell Biol</source>
            <pubdate>2005</pubdate>
            <volume>124</volume>
            <issue>2</issue>
            <fpage>177</fpage>
            <lpage>188</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00418-005-0013-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">16049695</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Quantitative real-time RT-PCR-a perspective</p>
            </title>
            <aug>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Benes</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Nolan</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Pfaffl</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>J Mol Endocrinol</source>
            <pubdate>2005</pubdate>
            <volume>34</volume>
            <fpage>597</fpage>
            <lpage>601</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1677/jme.1.01755</pubid>
                  <pubid idtype="pmpid" link="fulltext">15956331</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The lack of a systematic validation of reference genes: a serious pitfall undervalued in reverse transcription-polymerase chain reaction (RT-PCR) analysis in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Gutierrez</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Mauriat</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Guenin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pelloux</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lefebvre</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Louvet</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Rusterucci</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Moritz</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Guerineau</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Bellini</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Van Wuytswinkel</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>Plant Biotechnol J</source>
            <pubdate>2008</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18433420</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Jain</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nijhawan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tyagi</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Khurana</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Biochemical and Biophysical Research Communications</source>
            <pubdate>2006</pubdate>
            <volume>345</volume>
            <fpage>646</fpage>
            <lpage>651</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.bbrc.2006.04.140</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Control selection for RNA quantitation</p>
            </title>
            <aug>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Crawford</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Biotechniques</source>
            <pubdate>2000</pubdate>
            <volume>29</volume>
            <issue>2</issue>
            <fpage>332</fpage>
            <lpage>337</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10948434</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Accurate normalization of Real-Time quantitative RT-PCR by geometric averaging of multiple internal control genes</p>
            </title>
            <aug>
               <au>
                  <snm>Vandesompele</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>De Preter</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pattyn</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Poppe</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Van Roy</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>De Paepe</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Speleman</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <issue>7</issue>
            <fpage>34</fpage>
            <xrefbib>
               <pubid idtype="doi">10.1186/gb-2002-3-7-research0034</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies</p>
            </title>
            <aug>
               <au>
                  <snm>Tricarico</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pinzani</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bianchi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Paglierani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Distante</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Pazzagli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Orlando</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Anal Biochem</source>
            <pubdate>2002</pubdate>
            <volume>309</volume>
            <issue>2</issue>
            <fpage>293</fpage>
            <lpage>300</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0003-2697(02)00311-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">12413463</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Transcription profiling of signal transduction-related genes in sugarcane tissues</p>
            </title>
            <aug>
               <au>
                  <snm>Papini-Terzi</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Rocha</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>V&#234;ncio</snm>
                  <fnm>RZ</fnm>
               </au>
               <au>
                  <snm>Oliveira</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Felix Jde</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vicentini</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Rocha Cde</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sim&#245;es</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Ulian</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>di Mauro</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>da Silva</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Menossi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Souza</snm>
                  <fnm>GM</fnm>
               </au>
            </aug>
            <source>DNA Res</source>
            <pubdate>2005</pubdate>
            <volume>12</volume>
            <issue>1</issue>
            <fpage>27</fpage>
            <lpage>38</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/dnares/12.1.27</pubid>
                  <pubid idtype="pmpid" link="fulltext">16106750</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>In silico evaluation of the Eucalyptus transcriptome</p>
            </title>
            <aug>
               <au>
                  <snm>Vicentini</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sassaki</snm>
                  <fnm>FT</fnm>
               </au>
               <au>
                  <snm>Gimenes</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Maia</snm>
                  <fnm>IG</fnm>
               </au>
               <au>
                  <snm>Menossi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Genetics and Molecular Biology</source>
            <pubdate>2005</pubdate>
            <volume>28</volume>
            <fpage>487</fpage>
            <lpage>495</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1590/S1415-47572005000400002</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Identification and validation of suitable endogenous reference genes for gene expression studies of human bladder cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Ohl</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Radonic</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sachs</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Loening</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Urol</source>
            <pubdate>2006</pubdate>
            <volume>175</volume>
            <issue>5</issue>
            <fpage>1915</fpage>
            <lpage>1920</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0022-5347(05)00919-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">16600798</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage</p>
            </title>
            <aug>
               <au>
                  <snm>Pombo-Suarez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Calaza</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gomez-Reino</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>BMC Mol Biol</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>17</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2248200</pubid>
                  <pubid idtype="pmpid" link="fulltext">18226276</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-9-17</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Selection of housekeeping genes for gene expression studies in larvae from flatfish using real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Infante</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Matsuoka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Asensio</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Canavate</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reith</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Manchado</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>BMC Mol Biol</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>28</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2275743</pubid>
                  <pubid idtype="pmpid" link="fulltext">18325098</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-9-28</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Reference genes for normalization: A study of rat brain tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Bonefeld</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Elfving</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Wegener</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Synapse</source>
            <pubdate>2008</pubdate>
            <volume>62</volume>
            <issue>4</issue>
            <fpage>302</fpage>
            <lpage>309</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/syn.20496</pubid>
                  <pubid idtype="pmpid" link="fulltext">18241047</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model</p>
            </title>
            <aug>
               <au>
                  <snm>Langnaese</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>John</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schweizer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ebmeyer</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Keilhoff</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>BMC Mol Biol</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <issue>1</issue>
            <fpage>53</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2430208</pubid>
                  <pubid idtype="pmpid" link="fulltext">18505597</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-9-53</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Identifying the most suitable endogenous control for determining gene expression in hearts from organ donors</p>
            </title>
            <aug>
               <au>
                  <snm>Perez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Royo</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Astudillo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Escudero</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Alvarez</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Rodriguez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Otero</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>BMC Molecular Biology</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <issue>1</issue>
            <fpage>114</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2234425</pubid>
                  <pubid idtype="pmpid" link="fulltext">18096027</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-8-114</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Regulation of hypoxanthine phosphoribosyltransferase, glyceraldehyde-3-phosphate dehydrogenase and beta-actin mRNA expression in porcine immune cells and tissues</p>
            </title>
            <aug>
               <au>
                  <snm>Foss</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Baarsch</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Murtaugh</snm>
                  <fnm>MP</fnm>
               </au>
            </aug>
            <source>Anim Biotechnol</source>
            <pubdate>1998</pubdate>
            <volume>9</volume>
            <issue>1</issue>
            <fpage>67</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9676236</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Housekeeping genes as internal standards: use and limits</p>
            </title>
            <aug>
               <au>
                  <snm>Thellin</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Zorzi</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Lakaye</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>De Borman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Coumans</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hennen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Grisar</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Igout</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Heinen</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Biotechnol</source>
            <pubdate>1999</pubdate>
            <volume>75</volume>
            <issue>2&#8211;3</issue>
            <fpage>291</fpage>
            <lpage>295</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-1656(99)00163-7</pubid>
                  <pubid idtype="pmpid">10617337</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Control genes and variability: absence of ubiquitous reference transcripts in diverse mammalian expression studies</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Sladek</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Greenwood</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Hudson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2002</pubdate>
            <volume>12</volume>
            <issue>2</issue>
            <fpage>292</fpage>
            <lpage>297</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">155273</pubid>
                  <pubid idtype="pmpid" link="fulltext">11827948</pubid>
                  <pubid idtype="doi">10.1101/gr.217802</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis</p>
            </title>
            <aug>
               <au>
                  <snm>Czechowski</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Stitt</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Altmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Udvardi</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Scheible</snm>
                  <fnm>WR</fnm>
               </au>
            </aug>
            <source>Plant physiology</source>
            <pubdate>2005</pubdate>
            <volume>139</volume>
            <fpage>5</fpage>
            <lpage>17</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1203353</pubid>
                  <pubid idtype="pmpid" link="fulltext">16166256</pubid>
                  <pubid idtype="doi">10.1104/pp.105.063743</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Cloning and characterization of glyceraldehyde-3-phosphate dehydrogenase cDNA of Japanese flounder Paralichthys olivaceus</p>
            </title>
            <aug>
               <au>
                  <snm>Aoki</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Naka</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Katagiri</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hirono</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Fisheries Sci</source>
            <pubdate>2000</pubdate>
            <volume>66</volume>
            <fpage>737</fpage>
            <lpage>742</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1046/j.1444-2906.2000.00120.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon</p>
            </title>
            <aug>
               <au>
                  <snm>Olsvik</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Lie</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Jordal</snm>
                  <fnm>AEO</fnm>
               </au>
               <au>
                  <snm>Nilsen</snm>
                  <fnm>TO</fnm>
               </au>
               <au>
                  <snm>Hordvik</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>BMC Mol Biol</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>21</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1314898</pubid>
                  <pubid idtype="pmpid" link="fulltext">16293192</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-6-21</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Development and validation of endogenous reference genes for expression profiling of medaka (Oryzias latipes) exposed to endocrine disrupting chemicals by quantitative real-time RT-PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Toxicol Sci</source>
            <pubdate>2007</pubdate>
            <volume>95</volume>
            <issue>2</issue>
            <fpage>356</fpage>
            <lpage>368</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/toxsci/kfl161</pubid>
                  <pubid idtype="pmpid" link="fulltext">17093204</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization</p>
            </title>
            <aug>
               <au>
                  <snm>Dheda</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Huggett</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bustin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rook</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Zumla</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Anal Biochem</source>
            <pubdate>2005</pubdate>
            <volume>344</volume>
            <fpage>141</fpage>
            <lpage>143</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ab.2005.05.022</pubid>
                  <pubid idtype="pmpid" link="fulltext">16054107</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Control genes in quantitative molecular biological techniques: the variability of invariance</p>
            </title>
            <aug>
               <au>
                  <snm>Sturzenbaum</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Kille</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Comp Biochem Physiol B Biochem Mol Biol</source>
            <pubdate>2001</pubdate>
            <volume>130</volume>
            <issue>3</issue>
            <fpage>281</fpage>
            <lpage>289</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1096-4959(01)00440-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">11567890</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Validating internal controls for quantitative plant gene expression studies</p>
            </title>
            <aug>
               <au>
                  <snm>Brunner</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Yakovlev</snm>
                  <fnm>IA</fnm>
               </au>
               <au>
                  <snm>Strauss</snm>
                  <fnm>SH</fnm>
               </au>
            </aug>
            <source>BMC Plant Biol</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>14</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">515301</pubid>
                  <pubid idtype="pmpid" link="fulltext">15317655</pubid>
                  <pubid idtype="doi">10.1186/1471-2229-4-14</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Validation of housekeeping genes for normalizing RNA expression in real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Dheda</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Huggett</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Rook</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Zumla</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Biotechniques</source>
            <pubdate>2004</pubdate>
            <volume>37</volume>
            <issue>1</issue>
            <fpage>112</fpage>
            <lpage>119</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15283208</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Guideline to reference gene selection for quantitative real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Radonic</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Thulke</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mackay</snm>
                  <fnm>IM</fnm>
               </au>
               <au>
                  <snm>Landt</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Siegert</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Nitsche</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2004</pubdate>
            <volume>313</volume>
            <issue>4</issue>
            <fpage>856</fpage>
            <lpage>862</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2003.11.177</pubid>
                  <pubid idtype="pmpid" link="fulltext">14706621</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress</p>
            </title>
            <aug>
               <au>
                  <snm>Nicot</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hausman</snm>
                  <fnm>J-F</fnm>
               </au>
               <au>
                  <snm>Hoffmann</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Evers</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Exp Bot</source>
            <pubdate>2005</pubdate>
            <volume>56</volume>
            <issue>421</issue>
            <fpage>2907</fpage>
            <lpage>2914</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jxb/eri285</pubid>
                  <pubid idtype="pmpid" link="fulltext">16188960</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes</p>
            </title>
            <aug>
               <au>
                  <snm>Ding</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Jia</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Agric Food Chem</source>
            <pubdate>2004</pubdate>
            <volume>52</volume>
            <issue>11</issue>
            <fpage>3372</fpage>
            <lpage>3377</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1021/jf049915d</pubid>
                  <pubid idtype="pmpid" link="fulltext">15161200</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Normalization of reverse transcription quantitative-PCR with housekeeping genes in rice</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Nam</snm>
                  <fnm>HY</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>SU</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>SI</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>YJ</fnm>
               </au>
            </aug>
            <source>Biotechnol Lett</source>
            <pubdate>2003</pubdate>
            <volume>25</volume>
            <issue>21</issue>
            <fpage>1869</fpage>
            <lpage>1872</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1026298032009</pubid>
                  <pubid idtype="pmpid" link="fulltext">14677714</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Validation of internal control for gene expression study in soybean by quantitative real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Jian</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hou</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>BMC Molecular Biology</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <issue>1</issue>
            <fpage>59</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2443375</pubid>
                  <pubid idtype="pmpid" link="fulltext">18573215</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-9-59</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Identification of four soybean reference genes for gene expression normalization</p>
            </title>
            <aug>
               <au>
                  <snm>Libault</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Thibivilliers</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bilgin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Radwan</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Benitez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Clough</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Stacey</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>The Plant Genome</source>
            <pubdate>2008</pubdate>
            <volume>1</volume>
            <fpage>44</fpage>
            <lpage>54</lpage>
            <xrefbib>
               <pubid idtype="doi">10.3835/plantgenome2008.02.0091</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Coffee biotechnology</p>
            </title>
            <aug>
               <au>
                  <snm>De Los Santos-Briones</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hern&#225;ndez-Sotomayor</snm>
                  <fnm>SMT</fnm>
               </au>
            </aug>
            <source>Brazilian Journal of Plant Physiology</source>
            <pubdate>2006</pubdate>
            <volume>18</volume>
            <fpage>217</fpage>
            <lpage>227</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1590/S1677-04202006000100015</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>BestKeeper Software</p>
            </title>
            <url>http://www.gene-quantification.de/bestkeeper.html</url>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper &#8211; Excel-based tool using pair-wise correlations</p>
            </title>
            <aug>
               <au>
                  <snm>Pfaffl</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Tichopad</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Prgomet</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Neuvians</snm>
                  <fnm>TP</fnm>
               </au>
            </aug>
            <source>Biotechnol Lett</source>
            <pubdate>2004</pubdate>
            <volume>26</volume>
            <issue>6</issue>
            <fpage>509</fpage>
            <lpage>515</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/B:BILE.0000019559.84305.47</pubid>
                  <pubid idtype="pmpid" link="fulltext">15127793</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase</p>
            </title>
            <aug>
               <au>
                  <snm>Singh</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1993</pubdate>
            <volume>259</volume>
            <issue>5093</issue>
            <fpage>365</fpage>
            <lpage>368</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.8420004</pubid>
                  <pubid idtype="pmpid" link="fulltext">8420004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Evidence that glyceraldehyde-3-phosphate dehydrogenase is involved in age-induced apoptosis in mature cerebellar neurons in culture</p>
            </title>
            <aug>
               <au>
                  <snm>Ishitani</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sunaga</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hirano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Saunders</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Katsube</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Chuang</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>1996</pubdate>
            <volume>66</volume>
            <issue>3</issue>
            <fpage>928</fpage>
            <lpage>935</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8769851</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>NormFinder Software</p>
            </title>
            <url>http://www.mdl.dk/publicationsnormfinder.htm</url>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Comparison of reference genes for quantitative real-time polymerase chain reaction analysis of gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Iskandar</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Simpson</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Casu</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Bonnett</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Maclean</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Manners</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol Rep</source>
            <pubdate>2004</pubdate>
            <volume>22</volume>
            <fpage>325</fpage>
            <lpage>337</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF02772676</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>beta-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels</p>
            </title>
            <aug>
               <au>
                  <snm>Glare</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Divjak</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bailey</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Walters</snm>
                  <fnm>EH</fnm>
               </au>
            </aug>
            <source>Thorax</source>
            <pubdate>2002</pubdate>
            <volume>57</volume>
            <issue>9</issue>
            <fpage>765</fpage>
            <lpage>770</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1746418</pubid>
                  <pubid idtype="pmpid" link="fulltext">12200519</pubid>
                  <pubid idtype="doi">10.1136/thorax.57.9.765</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Expression stability of six housekeeping genes: A proposal for resistance gene quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Savli</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Karadenizli</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kolayli</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gundes</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ozbek</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Vahaboglu</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Med Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>52</volume>
            <issue>Pt 5</issue>
            <fpage>403</fpage>
            <lpage>408</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1099/jmm.0.05132-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">12721316</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Coffee (Coffea arabica L.) genes early expressed during infection by the rust fungus (Hemileia vastatrix)</p>
            </title>
            <aug>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Agostini</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bon</snm>
                  <fnm>M-C</fnm>
               </au>
               <au>
                  <snm>Petitot</snm>
                  <fnm>A-S</fnm>
               </au>
               <au>
                  <snm>C Silva</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Guerra-Guimaraes</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Ribeiro</snm>
                  <fnm>ANA</fnm>
               </au>
               <au>
                  <snm>Argout</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Nicole</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Molecular Plant Pathology</source>
            <pubdate>2004</pubdate>
            <volume>5</volume>
            <issue>6</issue>
            <fpage>527</fpage>
            <lpage>536</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1364-3703.2004.00250.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Monitoring of the early molecular resistance responses of coffee (Coffea arabica L.) to the rust fungus (Hemileia vastatrix) using real-time quantitative RT-PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Ganesh</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Petitot</snm>
                  <fnm>A-S</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Alary</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lecouls</snm>
                  <fnm>A-C</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Plant Science</source>
            <pubdate>2006</pubdate>
            <volume>170</volume>
            <issue>6</issue>
            <fpage>1045</fpage>
            <lpage>1051</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.plantsci.2005.12.009</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Coffee resistance to the main diseases: leaf rust and coffee berry disease</p>
            </title>
            <aug>
               <au>
                  <snm>Silva</snm>
                  <fnm>MdC</fnm>
               </au>
               <au>
                  <snm>V&#225;rzea</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Guerra-Guimar&#227;es</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Azinheira</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Petitot</snm>
                  <fnm>A-S</fnm>
               </au>
               <au>
                  <snm>Bertrand</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Lashermes</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Nicole</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Brazilian Journal of Plant Physiology</source>
            <pubdate>2006</pubdate>
            <volume>18</volume>
            <fpage>119</fpage>
            <lpage>147</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1590/S1677-04202006000100010</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Sub-genomic origin and regulation patterns of a duplicated WRKY gene in the allotetraploid species Coffea arabica</p>
            </title>
            <aug>
               <au>
                  <snm>Petitot</snm>
                  <fnm>A-S</fnm>
               </au>
               <au>
                  <snm>Lecouls</snm>
                  <fnm>A-C</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Tree Genetics &amp; Genomes</source>
            <pubdate>2007</pubdate>
            <volume>4</volume>
            <fpage>379</fpage>
            <lpage>390</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s11295-007-0117-x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Analysis of relative gene expression data using real-time quantitative PCR and the 2-&#916;&#916;Ct method</p>
            </title>
            <aug>
               <au>
                  <snm>Livak</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Schmittgen</snm>
                  <fnm>TD</fnm>
               </au>
            </aug>
            <source>Methods</source>
            <pubdate>2001</pubdate>
            <volume>25</volume>
            <fpage>402</fpage>
            <lpage>408</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/meth.2001.1262</pubid>
                  <pubid idtype="pmpid" link="fulltext">11846609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Saint</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Anal Biochem</source>
            <pubdate>2002</pubdate>
            <volume>302</volume>
            <fpage>52</fpage>
            <lpage>59</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/abio.2001.5530</pubid>
                  <pubid idtype="pmpid" link="fulltext">11846375</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>An overview of real time quantitative PCR: Applications to quantify cytokine gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Giulietti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Overbergh</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Valckx</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Decallonne</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bouillon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mathieu</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Methods</source>
            <pubdate>2001</pubdate>
            <volume>25</volume>
            <fpage>386</fpage>
            <lpage>401</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/meth.2001.1261</pubid>
                  <pubid idtype="pmpid" link="fulltext">11846608</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>A reliability test of standard-based quantitative PCR: Exogenous vs. endogenous standards</p>
            </title>
            <aug>
               <au>
                  <snm>Ke</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Yung</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Mol Cell Probes</source>
            <pubdate>2000</pubdate>
            <volume>14</volume>
            <fpage>127</fpage>
            <lpage>135</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/mcpr.2000.0288</pubid>
                  <pubid idtype="pmpid" link="fulltext">10799275</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Serial analysis of gene expression in sugarcane (Saccharum spp.) leaves revealed alternative C4 metabolism and putative antisense transcripts</p>
            </title>
            <aug>
               <au>
                  <snm>Calsa</snm>
                  <fnm>T</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Figueira</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>2007</pubdate>
            <volume>63</volume>
            <issue>6</issue>
            <fpage>745</fpage>
            <lpage>762</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s11103-006-9121-z</pubid>
                  <pubid idtype="pmpid" link="fulltext">17211512</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Rapid isolation of total RNA and genomic DNA from Hakea actities</p>
            </title>
            <aug>
               <au>
                  <snm>Mason</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Funct Plant Biol</source>
            <pubdate>2002</pubdate>
            <volume>29</volume>
            <fpage>1013</fpage>
            <lpage>1016</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1071/PP01151</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Brazilian coffee genome project: an EST-based genomic resource</p>
            </title>
            <aug>
               <au>
                  <snm>Vieira</snm>
                  <fnm>LGE</fnm>
               </au>
               <au>
                  <snm>Andrade</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Colombo</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Moraes</snm>
                  <fnm>AHdA</fnm>
               </au>
               <au>
                  <snm>Metha</snm>
                  <fnm>&#194;</fnm>
               </au>
               <au>
                  <snm>Oliveira</snm>
                  <fnm>ACd</fnm>
               </au>
               <au>
                  <snm>Labate</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Marino</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Monteiro-Vitorello</snm>
                  <fnm>CdB</fnm>
               </au>
               <au>
                  <snm>Monte</snm>
                  <fnm>DdC</fnm>
               </au>
               <au>
                  <snm>Giglioti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kimura</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Romano</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kuramae</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Lemos</snm>
                  <fnm>EGM</fnm>
               </au>
               <au>
                  <snm>Almeida</snm>
                  <fnm>ERP</fnm>
               </au>
               <au>
                  <snm>Jorge</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Albuquerque</snm>
                  <fnm>EVS</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>Vinecky</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Sawazaki</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Dorry</snm>
                  <fnm>HFA</fnm>
               </au>
               <au>
                  <snm>Carrer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Abreu</snm>
                  <fnm>IN</fnm>
               </au>
               <au>
                  <snm>Batista</snm>
                  <fnm>JAN</fnm>
               </au>
               <au>
                  <snm>Teixeira</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Kitajima</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Xavier</snm>
                  <fnm>KG</fnm>
               </au>
               <au>
                  <snm>Lima</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Camargo</snm>
                  <fnm>LEA</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>LFP</fnm>
               </au>
               <au>
                  <snm>Coutinho</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Lemos</snm>
                  <fnm>MVF</fnm>
               </au>
               <au>
                  <snm>Romano</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Machado</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Costa</snm>
                  <fnm>MMC</fnm>
               </au>
               <au>
                  <snm>Grossi-de-S&#225;</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Goldman</snm>
                  <fnm>MHS</fnm>
               </au>
               <au>
                  <snm>Ferro</snm>
                  <fnm>MIT</fnm>
               </au>
               <au>
                  <snm>Tinoco</snm>
                  <fnm>MLP</fnm>
               </au>
               <au>
                  <snm>Oliveira</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Van Sluys</snm>
                  <fnm>M-A</fnm>
               </au>
               <au>
                  <snm>Shimizu</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Maluf</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Eira</snm>
                  <fnm>MTS</fnm>
               </au>
               <au>
                  <snm>Guerreiro Filho</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Arruda</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mazzafera</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mariani</snm>
                  <fnm>PDSC</fnm>
               </au>
               <au>
                  <snm>Oliveira</snm>
                  <fnm>RLBC</fnm>
               </au>
               <au>
                  <snm>Harakava</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Balbao</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Tsai</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Mauro</snm>
                  <fnm>SMZ</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>SN</fnm>
               </au>
               <au>
                  <snm>Siqueira</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Costa</snm>
                  <fnm>GGL</fnm>
               </au>
               <au>
                  <snm>Formighieri</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Carazzolle</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>GAG</fnm>
               </au>
            </aug>
            <source>Brazilian Journal of Plant Physiology</source>
            <pubdate>2006</pubdate>
            <volume>18</volume>
            <fpage>95</fpage>
            <lpage>108</lpage>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Coffee Genome Project</p>
            </title>
            <url>http://www.lge.ibi.unicamp.br/cafe/</url>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Solanaceae Genome Project (SOL)</p>
            </title>
            <url>http://www.sgn.cornell.edu/content/coffee.pl</url>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Quantification strategies in real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Pfaffl</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>The real-time PCR encyclopaedia A-Z of quantitative PCR</source>
            <pubdate>2004</pubdate>
            <fpage>87</fpage>
            <lpage>120</lpage>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data</p>
            </title>
            <aug>
               <au>
                  <snm>Ramakers</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ruijter</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Deprez</snm>
                  <fnm>RHL</fnm>
               </au>
               <au>
                  <snm>Moorman</snm>
                  <fnm>AFM</fnm>
               </au>
            </aug>
            <source>Neuroscience Letters</source>
            <pubdate>2003</pubdate>
            <volume>339</volume>
            <fpage>62</fpage>
            <lpage>66</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0304-3940(02)01423-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">12618301</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>A new mathematical model for relative quantification in real-time RT-PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Pfaffl</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2001</pubdate>
            <volume>29</volume>
            <fpage>e45</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">55695</pubid>
                  <pubid idtype="pmpid" link="fulltext">11328886</pubid>
                  <pubid idtype="doi">10.1093/nar/29.9.e45</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>geNorm Software</p>
            </title>
            <url>http://medgen.ugent.be/~jvdesomp/genorm/</url>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Induction and differentiation of reproductive buds in Coffea arabica L</p>
            </title>
            <aug>
               <au>
                  <snm>Majerowicz</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>S&#246;ndahl</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Brazilian Journal of Plant Physiology</source>
            <pubdate>2005</pubdate>
            <volume>17</volume>
            <fpage>247</fpage>
            <lpage>254</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1590/S1677-04202005000200008</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>Escala para avalia&#231;&#227;o de est&#225;dios fenol&#243;gicos do cafeeiro ar&#225;bica</p>
            </title>
            <aug>
               <au>
                  <snm>Pezzopane</snm>
                  <fnm>JRM</fnm>
               </au>
               <au>
                  <snm>Pedro J&#250;nior</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Thomaziello</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Camargo</snm>
                  <fnm>MBPd</fnm>
               </au>
            </aug>
            <source>Bragantia</source>
            <pubdate>2003</pubdate>
            <volume>62</volume>
            <fpage>499</fpage>
            <lpage>505</lpage>
         </bibl>
         <bibl id="B72">
            <title>
               <p>Escala fenol&#243;gica detalhada da fase reprodutiva de Cooffea arabica</p>
            </title>
            <aug>
               <au>
                  <snm>Morais</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Caramori</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Koguishi</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Ribeiro</snm>
                  <fnm>AMdA</fnm>
               </au>
            </aug>
            <source>Bragantia</source>
            <pubdate>2008</pubdate>
            <volume>67</volume>
            <fpage>257</fpage>
            <lpage>260</lpage>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Cytology, biochemistry and molecular changes during coffee fruit development</p>
            </title>
            <aug>
               <au>
                  <snm>De Castro</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Marraccini</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Brazilian Journal of Plant Physiology</source>
            <pubdate>2006</pubdate>
            <volume>18</volume>
            <fpage>175</fpage>
            <lpage>199</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1590/S1677-04202006000100013</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
