<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2180-8-178</ui>
   <ji>1471-2180</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Rapid screening of <it>Salmonella enterica </it>serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Hong</snm>
               <fnm>Yang</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>yang.hong@primuslabs.com</email>
            </au>
            <au id="A2">
               <snm>Liu</snm>
               <fnm>Tongrui</fnm>
               <insr iid="I1"/>
               <insr iid="I6"/>
               <email>jmaurer@uga.edu</email>
            </au>
            <au id="A3">
               <snm>Lee</snm>
               <mi>D</mi>
               <fnm>Margie</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>mdlee@uga.edu</email>
            </au>
            <au id="A4">
               <snm>Hofacre</snm>
               <mi>L</mi>
               <fnm>Charles</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>chofacre@uga.edu</email>
            </au>
            <au id="A5">
               <snm>Maier</snm>
               <fnm>Marie</fnm>
               <insr iid="I1"/>
               <insr iid="I6"/>
               <email>jmaurer@uga.edu</email>
            </au>
            <au id="A6">
               <snm>White</snm>
               <mi>G</mi>
               <fnm>David</fnm>
               <insr iid="I5"/>
               <email>david.white@fda.hhs.gov</email>
            </au>
            <au id="A7">
               <snm>Ayers</snm>
               <fnm>Sherry</fnm>
               <insr iid="I5"/>
               <email>sherry.ayers@fda.hhs.gov</email>
            </au>
            <au id="A8">
               <snm>Wang</snm>
               <fnm>Lihua</fnm>
               <insr iid="I3"/>
               <email>yang.hong@primuslabs.com</email>
            </au>
            <au id="A9">
               <snm>Berghaus</snm>
               <fnm>Roy</fnm>
               <insr iid="I1"/>
               <email>berghaus@uga.edu</email>
            </au>
            <au id="A10" ca="yes">
               <snm>Maurer</snm>
               <mi>J</mi>
               <fnm>John</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>jmaurer@uga.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Population Health, The University of Georgia, Athens, GA 30602, USA</p>
            </ins>
            <ins id="I2">
               <p>Department of Infectious Diseases, The University of Georgia, Athens, GA, USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Statistics, The University of Georgia, Athens, GA 30602, USA</p>
            </ins>
            <ins id="I4">
               <p>Center for Food Safety and Quality Enhancement, The University of Georgia, Griffin, GA 30223, USA</p>
            </ins>
            <ins id="I5">
               <p>Center for Veterinary Medicine, U.S. Food and Drug Administration, Laurel, MD 20708, USA</p>
            </ins>
            <ins id="I6">
               <p>USDA ARS, Russell Research Center, 950 College Station road, Athens, GA 30605. T. Liu- Emory University, 1701 Uppergate Drive, Atlanta, GA 30322, USA</p>
            </ins>
         </insg>
         <source>BMC Microbiology</source>
         <issn>1471-2180</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>178</fpage>
         <url>http://www.biomedcentral.com/1471-2180/8/178</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18845003</pubid>
               <pubid idtype="doi">10.1186/1471-2180-8-178</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>12</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>09</day>
               <month>10</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>09</day>
               <month>10</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Hong et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Classical <it>Salmonella </it>serotyping is an expensive and time consuming process that requires implementing a battery of O and H antisera to detect 2,541 different <it>Salmonella enterica </it>serovars. For these reasons, we developed a rapid multiplex polymerase chain reaction (PCR)-based typing scheme to screen for the prevalent <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>By analyzing the nucleotide sequences of the genes for O-antigen biosynthesis including <it>wb</it>a operon and the central variable regions of the H1 and H2 flagellin genes in <it>Salmonella</it>, designated PCR primers for four multiplex PCR reactions were used to detect and differentiate <it>Salmonella </it>serogroups A/D1, B, C1, C2, or E1; H1 antigen types i, g, m, r or z<sub>10</sub>; and H2 antigen complexes, I: 1,2; 1,5; 1,6; 1,7 or II: e,n,x; e,n,z<sub>15</sub>. Through the detection of these antigen gene allele combinations, we were able to distinguish among <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. The assays were useful in identifying <it>Salmonella </it>with O and H antigen gene alleles representing 43 distinct serovars. While the H2 multiplex could discriminate between unrelated H2 antigens, the PCR could not discern differences within the antigen complexes, 1,2; 1,5; 1,6; 1,7 or e,n,x; e,n,z<sub>15</sub>, requiring a final confirmatory PCR test in the final serovar reporting of <it>S. enterica</it>.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Multiplex PCR assays for detecting specific O and H antigen gene alleles can be a rapid and cost-effective alternative approach to classical serotyping for presumptive identification of <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>There are approximately 15 cases of salmonellosis per 100,000 persons annually in the United States, more than double the 2010 Healthy People goal of 6.8 cases/100,000 individuals per year <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. In order to reduce human illnesses, epidemiological measures have been implemented to reduce the source(s) of infection. Because food animals and poultry are recognized as important reservoirs of <it>Salmonella </it><abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>, the United States Department of Agriculture (USDA) Food Safety Inspection Service (FSIS) implemented an "in plant" Hazard Analysis and Critical Control Point (HACCP) program to reduce the prevalence of foodborne pathogen contamination in meats, eggs, and milk. Although in-plant HACCP programs have been successful, further reductions in <it>Salmonella </it>contamination may require application of a risk reduction strategy to the farm environment. On-farm control programs have been effective in the past when they have been directed against vertically-transmitted <it>S. enterica </it>serovars (such as <it>S</it>. <it>enterica </it>serovar Enteritidis and <it>S</it>. <it>enterica </it>serovar Gallinarum) <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, but it is unclear whether this approach could be effective against all serovars. A more achievable goal may be to mitigate those <it>S. enterica </it>serovars that are most frequently associated with severe human illness. To further reduce <it>Salmonella </it>contamination in or on the final food product, producers may need to reduce its prevalence in animals brought into the meat processing plant. Producers may also need to accurately identify the source of <it>Salmonella </it>within a specific setting, in order to identify the points where an intervention <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> may be effective. Such an approach would require knowing whether these serovars are present on the farm. Also, determining the appropriate <it>S. enterica </it>serovar is a necessary first step in any epidemiological investigation of foodborne outbreaks; followed then by strain typing, using molecular based methods including pulsed-field gel electrophoresis (PFGE) <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> or amplified fragment length polymorphism that is needed to match patient strain to source <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Serotyping can be a formidable task because of the numerous antisera required and the expertise necessary for interpreting the agglutination reactions, thereby limiting its efficacy as a large scale screening tool.</p>
         <p>There are currently 2,541 <it>S. enterica </it>serovars recognized based on antigenic differences in the lipopolysaccharide (LPS) O-antigen; and phase 1 (H1) and phase 2 (H2) flagellar antigens <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. <it>Salmonella </it>can be further separated into monophasic and biphasic based on whether they express only one (H1) or both flagellar antigens (H1 and H2). The antigenic formula 4,5,12 (O): i (H1): 1,2 (H2) is the biphasic <it>S. enterica </it>serovar Typhimurium and 1,9,12 (O):g,m (H1):- (no H2) identifies the monophasic <it>S. enterica </it>serovar Enteritidis. Among the 2,541 <it>S. enterica </it>serovars identified to date, 10 <it>S. enterica </it>serovars: Typhimurium, Enteritidis, Newport, Heidelberg, Javiana, 4, <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>, 12:i:-, Montevideo, Muenchen, Saintpaul, and Braenderup, currently account for 66% of all cases of laboratory-confirmed salmonellosis in the U.S. <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Between 1998&#8211;2006, <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium also accounted for 48% of all <it>S. enterica </it>serovars isolated from poultry, including chicken broilers, ground chicken and ground turkey, in the U.S. <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Worldwide, two serovars, Enteritidis and Typhimurium are responsible for 79% of reported cases of salmonellosis <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p><it>Salmonella </it>serotyping is based on the identification of the variable O and H antigens. Because the antigenic composition of the O, H1 and H2 antigens are a reflection of their unique DNA sequence alleles <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>, PCR and similar nucleotide-based methods have made it possible to accelerate the identification of serotypes based upon the identification of unique genes or gene arrangements <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp> and use as a diagnostic tool <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. We report here on the development and validation of a serologically-correlative PCR-based assay that could solve a number of the logistical challenges faced by diagnostic and food microbiology labs.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Multiplex PCR differentiation of <it>Salmonella enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium</p>
            </st>
            <p>We developed multiplex PCRs targeted to the O, H1, and H2 alleles associated with four <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. Specific PCR primers to identify specific <it>Salmonella </it>serogroups, H1 and H2 alleles were designed based on the divergence of the glycosyl synthase genes, the unique linkage between two genes for a specific O-antigen of <it>Salmonella</it>, or allele-specific sequences within the hypervariable region of H1 and H2 antigen genes. In the primer design, a unique amplicon size was selected in order to facilitate development of a multiplex PCR (Table <tblr tid="T1">1</tblr>, Fig. <figr fid="F1">1</figr> &amp;<figr fid="F2">2</figr>). The ability of the multiplex PCR to correctly identify serogroups (Fig. <figr fid="F1">1</figr>) was evaluated for 239 <it>Salmonella </it>isolates representing forty-three different serotypes which belonged to one of the six major serogroups, A, B, C1, C2, D1 and E1. With the exception of serogroups A and D1, which produce the same size amplicons (Kappa = 0.98), the multiplex PCR accurately distinguished salmonellae belonging to serogroups B, C1, C2, and E1 (Kappa = 1.00) (Table <tblr tid="T2">2</tblr>). The inability to distinguish serogroups A and D1 is due to the high degree of nucleotide sequence homology between the <it>prt </it>(paratose synthase) genes <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. The <it>fliC </it>multiplex PCRs successfully detected the H1, i, r, or z<sub>10</sub>, alleles (Fig. <figr fid="F2">2A</figr>) and no amplicons were produced for serovars with other H1, flagellins (Kappa = 1.00) (Table <tblr tid="T2">2</tblr>). However, the <it>fliC </it>g,m primer set produced the same size amplicon only for salmonellae that possessed both the g and m, or g alone, or either epitope, g or m, in combination with other serotype-specific epitopes, or non-motile salmonellae that possess the <it>fliC </it>g,m allele <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and therefore it did not have the specificity of the other H1 primer sets (Kappa = 0.58 vs. 1.00) (Table <tblr tid="T2">2</tblr>). To complement our PCR-based H allelotyping, a <it>fljB </it>multiplex PCR was designed to detect the H2 antigen alleles by targeting conserved regions within <it>fljB </it>alleles encoding the antigen complexes I: 1,2; 1,5; 1,6; 1,7 or II: e,n,x; e,n,z<sub>15 </sub>and producing unique size amplicons (Table <tblr tid="T1">1</tblr>, Fig. <figr fid="F2">2B</figr>). The expected size amplicons were produced for only those <it>S. enterica </it>serovars belonging to H2 antigen complexes I: 1,2; 1,5; 1,6: 1,7 and. II: e,n,x; e,n,z<sub>15 </sub>(Fig. <figr fid="F2">2B</figr>). The H2 multiplex PCR however could not distinguish H2 1,2 allele (Kappa = 0.75) or e,n,x (Kappa = 0.54) among the different H2 alleles within each antigen complex; for example indistinguishable amplicons were produced for <it>Salmonella </it>isolates bearing 1,2 vs 1,5; 1,6; or 1,7 (Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primers used for multiplex PCR to detect and differentiate <it>Salmonella enterica </it>serogroups and serovars</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Target gene</b>
                           <sup>1</sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Nucleotide sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Expected Size (bp)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>O-antigen multiplex</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>abe</it><sub>1 </sub>(B)</p>
                     </c>
                     <c ca="left">
                        <p>F: GGCTTCCGGCTTTATTGG</p>
                     </c>
                     <c ca="center">
                        <p>561</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TCTCTTATCTGTTCGCCTGTTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>wbaD-manC </it>(C1)</p>
                     </c>
                     <c ca="left">
                        <p>F: ATTTGCCCAGTTCGGTTTG</p>
                     </c>
                     <c ca="center">
                        <p>341</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCATAACCGACTTCCATTTCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>abe</it><sub>2 </sub>(C2)</p>
                     </c>
                     <c ca="left">
                        <p>F: CGTCCTATAACCGAGCCAAC</p>
                     </c>
                     <c ca="center">
                        <p>397</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CTGCTTTATCCCTCTCACCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>prt </it>(A/D1)</p>
                     </c>
                     <c ca="left">
                        <p>F: ATGGGAGCGTTTGGGTTC</p>
                     </c>
                     <c ca="center">
                        <p>624</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CGCCTCTCCACTACCAACTTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>wzx </it>&#8211; <it>wzy </it>(E1)</p>
                     </c>
                     <c ca="left">
                        <p>F: GATAGCAACGTTCGGAAATTC</p>
                     </c>
                     <c ca="center">
                        <p>281</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CCCAATAGCAATAAACCAAGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>H1-1 multiplex</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>fliC </it>(i)</p>
                     </c>
                     <c ca="left">
                        <p>F: AACGAAATCAACAACAACCTGC</p>
                     </c>
                     <c ca="center">
                        <p>508</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TAGCCATCTTTACCAGTTCCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>fliC </it>(g,m)</p>
                     </c>
                     <c ca="left">
                        <p>F: GCAGCAGCACCGGATAAAG</p>
                     </c>
                     <c ca="center">
                        <p>309</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: CATTAACATCCGTCGCGCTAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>H1-2 multiplex</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>fliC </it>(r)</p>
                     </c>
                     <c ca="left">
                        <p>F: CCTGCTATTACTGGTGATC</p>
                     </c>
                     <c ca="center">
                        <p>169</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GTTGAAGGGAAGCCAGCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>fliC </it>(z<sub>10</sub>)</p>
                     </c>
                     <c ca="left">
                        <p>F: GCACTGGCGTTACTCAATCTC</p>
                     </c>
                     <c ca="center">
                        <p>363</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: GCATCAGCAATACCACTCGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>H2 multiplex</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>fljB </it>(I: 1,2; 1,5; 1,6; 1,7)</p>
                     </c>
                     <c ca="left">
                        <p>F: AGAAAGCGTATGATGTGAAA</p>
                     </c>
                     <c ca="center">
                        <p>294</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: ATTGTGGTTTTAGTTGCGCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p><it>fljB </it>(II: e,n,x; e,n,z<sub>15</sub>)</p>
                     </c>
                     <c ca="left">
                        <p>F: TAACTGGCGATACATTGACTG</p>
                     </c>
                     <c ca="center">
                        <p>152</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>R: TAGCACCGAATGATACAGCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>1</sup>Indicates the unique genes or the junctions between the two genes used for designing PCR primers. () = antigen(s) detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Comparison of multiplex PCR to serotyping for identifying <it>Salmonella </it>O alleles B; C1; C2; D1 or E1; H1 alleles i; g,m; r or z<sub>10</sub>;and H2 alleles 1,2 or e,n,x</p>
               </caption>
               <tblbdy cols="16">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4" ca="center">
                        <p>
                           <b>Phase 1 PCRs</b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>Phase 2 multiplex PCR</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3" ca="center">
                        <p>
                           <b>Antigenic Formula</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>O muliplex PCR</b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>i/g,m multiplex PCR</b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>r/z</b>
                           <sub>10</sub>
                           <b>multiplex PCR</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="11">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>O</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>H1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>H2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b><it>S. enterica </it>Serovars</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Animal Origin (<it>n</it>)</b>
                           <sup>1</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>B</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>C1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>C2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>E1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>i</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>g,m</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>r</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>z</b>
                           <sub>10</sub>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>1,2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>e,n,x</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="16">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>a</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Paratyphi A</p>
                     </c>
                     <c ca="center">
                        <p>1 (1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>b</p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Paratyphi B</p>
                     </c>
                     <c ca="center">
                        <p>1 (1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Saintpaul</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Reading</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>f,g</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Derby</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>i</p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Typhimurium</p>
                     </c>
                     <c ca="center">
                        <p>1, 4&#8211;6 (74)</p>
                     </c>
                     <c ca="center">
                        <p>74</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>74</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>74</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>l,v</p>
                     </c>
                     <c ca="center">
                        <p>1,7</p>
                     </c>
                     <c ca="left">
                        <p>Bredeney</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>1,v</p>
                     </c>
                     <c ca="center">
                        <p>e,n,z<sub>15</sub></p>
                     </c>
                     <c ca="left">
                        <p>Brandenburg</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>b</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Java</p>
                     </c>
                     <c ca="center">
                        <p>6(1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>e,n,x</p>
                     </c>
                     <c ca="left">
                        <p>Chester</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>f,g,s</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Agona</p>
                     </c>
                     <c ca="center">
                        <p>1 (1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>r</p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Heidelberg</p>
                     </c>
                     <c ca="center">
                        <p>1, 3&#8211;6(24)</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>z</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Kiambu</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>z</p>
                     </c>
                     <c ca="center">
                        <p>1,7</p>
                     </c>
                     <c ca="left">
                        <p>Indiana</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>10</sub></p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Haifa</p>
                     </c>
                     <c ca="center">
                        <p>6 (1)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>b</p>
                     </c>
                     <c ca="center">
                        <p>l,w</p>
                     </c>
                     <c ca="left">
                        <p>Ohio</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>c</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Choleraesuis</p>
                     </c>
                     <c ca="center">
                        <p>1, 6(6)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>c</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Paratyphi C</p>
                     </c>
                     <c ca="center">
                        <p>1 (1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>d</p>
                     </c>
                     <c ca="center">
                        <p>l,w</p>
                     </c>
                     <c ca="left">
                        <p>Livingstone</p>
                     </c>
                     <c ca="center">
                        <p>6(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>g,m,s</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Montevideo</p>
                     </c>
                     <c ca="center">
                        <p>1, 5(12)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>k</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Thompson</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>m,t</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Oranienburg</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>29</sub></p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Tennessee</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>e,n,z<sub>15</sub></p>
                     </c>
                     <c ca="left">
                        <p>Braenderup</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>r</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Infantis</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>10</sub></p>
                     </c>
                     <c ca="center">
                        <p>e,n,z<sub>15</sub></p>
                     </c>
                     <c ca="left">
                        <p>Mbandaka</p>
                     </c>
                     <c ca="center">
                        <p>1(14)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C1</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>28</sub></p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Lille</p>
                     </c>
                     <c ca="center">
                        <p>1(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C2</p>
                     </c>
                     <c ca="center">
                        <p>d</p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Muenchen</p>
                     </c>
                     <c ca="center">
                        <p>5(3)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C2</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>1,2</p>
                     </c>
                     <c ca="left">
                        <p>Newport</p>
                     </c>
                     <c ca="center">
                        <p>4,5(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C2</p>
                     </c>
                     <c ca="center">
                        <p>i</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>6</sub></p>
                     </c>
                     <c ca="left">
                        <p>Kentucky</p>
                     </c>
                     <c ca="center">
                        <p>1(24)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C2</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>10</sub></p>
                     </c>
                     <c ca="center">
                        <p>e,n,x</p>
                     </c>
                     <c ca="left">
                        <p>Hadar</p>
                     </c>
                     <c ca="center">
                        <p>1 (10)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>a</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Miami</p>
                     </c>
                     <c ca="center">
                        <p>5(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>a</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Sendai</p>
                     </c>
                     <c ca="center">
                        <p>5(1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>g,m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Enteritidis</p>
                     </c>
                     <c ca="center">
                        <p>1(20)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>g,p</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Dublin</p>
                     </c>
                     <c ca="center">
                        <p>2, 6(3)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>l,v</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Panama</p>
                     </c>
                     <c ca="center">
                        <p>1 (1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Gallinarum</p>
                     </c>
                     <c ca="center">
                        <p>1(4)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>f,g,t</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Berta</p>
                     </c>
                     <c ca="center">
                        <p>1 (2)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>D1</p>
                     </c>
                     <c ca="center">
                        <p>l,z<sub>28</sub></p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Javiana</p>
                     </c>
                     <c ca="center">
                        <p>1 (1)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>E1</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>1,5</p>
                     </c>
                     <c ca="left">
                        <p>Muenster</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>E1</p>
                     </c>
                     <c ca="center">
                        <p>l,v</p>
                     </c>
                     <c ca="center">
                        <p>1,7</p>
                     </c>
                     <c ca="left">
                        <p>Give</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>E1</p>
                     </c>
                     <c ca="center">
                        <p>e,h</p>
                     </c>
                     <c ca="center">
                        <p>1,6</p>
                     </c>
                     <c ca="left">
                        <p>Anatum</p>
                     </c>
                     <c ca="center">
                        <p>1, 5 (4)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>E1</p>
                     </c>
                     <c ca="center">
                        <p>l,v</p>
                     </c>
                     <c ca="center">
                        <p>1,6</p>
                     </c>
                     <c ca="left">
                        <p>London</p>
                     </c>
                     <c ca="center">
                        <p>1(2)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Total</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>239</p>
                     </c>
                     <c ca="center">
                        <p>114</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c ca="center">
                        <p>34</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>98</p>
                     </c>
                     <c ca="center">
                        <p>44</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>135</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>False Positives</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>False Negatives</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Kappa<sup>2</sup></p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.58</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.75</p>
                     </c>
                     <c ca="center">
                        <p>0.54</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>1</sup>1 = poultry; 2 = bovine; 3 = swine, 4 = other (includes dog, heron, horse, opossum, parrot, rabbit, and snake); 5 = human; and 6 = unknown. Numbers in parentheses indicate the numbers of isolates for each serovar.</p>
                  <p><sup>2</sup>Agreement between PCR allelotyping and conventional serotyping results</p>
               </tblfn>
            </tbl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Multiplex PCR for identifying serogroup-specific, <it>Salmonella </it>O antigen biosynthesis gene(s)</p>
               </caption>
               <text>
                  <p><b>Multiplex PCR for identifying serogroup-specific, <it>Salmonella </it>O antigen biosynthesis gene(s)</b>. Lanes1 and 15: 100 bp MW standard; lane 2, multiplex PCR control for five <it>Salmonella </it>serogroups; lane 3: <it>S. enterica </it>serovar Paratyphi A [A]; lane 4: <it>S. enterica </it>serovar Enteritidis [D1]; lane 5: <it>S. enterica </it>serovar Muenchen [C2]; lane 6: <it>S. enterica </it>serovar Hadar [C2]; lane 7: <it>S. enterica </it>serovar Anatum [E1]; lane 8: <it>S. enterica </it>serovar London [E1]; lane 9: <it>S. enterica </it>serovar Infantis [C1]; lane 10: <it>S. enterica </it>serovar Tennessee [C1]; lane 11: <it>S. enterica </it>serovar Saintpaul [B]; lane 12, <it>S. enterica </it>serovar Typhimurium [B]; lane 13: <it>E. coli </it>K12 LE392, negative control; and lane 14: no DNA control. The sizes of the PCR amplicons are 624 bp for serogroup A/D1, 561 bp for serogroup B, 341 bp for serogroup C1, 397 bp for serogroup C2, and 281 bp for serogroup E1.</p>
               </text>
               <graphic file="1471-2180-8-178-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Multiplex PCR for identifying <it>Salmonella </it>H1 and H2 gene alleles</p>
               </caption>
               <text>
                  <p><b>Multiplex PCR for identifying <it>Salmonella </it>H1 and H2 gene alleles</b>. <b><it>(a) </it></b>Multiplex PCR for identifying H1 antigen gene alleles: i, g,m, r, and z<sub>10</sub>. Lanes 2&#8211;7: H1-1 multiplex PCR for i and g,m antigens. Lanes 9&#8211;14: H1-2, multiplex PCR for antigens r and z10. Lanes 1, 8, and 15: 100 bp MW standard; lane 2: H1-1 multiplex PCR control; lane 3: <it>S. enterica </it>serovar Typhimurium [i]; lane 4: <it>S. enterica </it>serovar Kentucky [i]; lanes 5 and 6: <it>S. enterica </it>serovar Enteritidis [g,m]; lane 7: no DNA control; lane 9: H1-2 multiplex PCR control; lane 10: <it>S. enterica </it>serovar Hadar [z<sub>10</sub>]; lane 11: <it>S. enterica </it>serovar Mbandaka [z<sub>10</sub>]; lane12: <it>S. enterica </it>Heidelberg [r]; lane 13: <it>S. enterica </it>serovar Infantis [r]; and lane 14: no DNA control. The sizes of the PCR amplicons are: 508 bp for i, 309 bp for g,m, 169 bp for r, and 363 bp for z<sub>10</sub>. <b><it>(b) </it></b>Multiplex PCR for identifying H2 antigen complexes I: 1,2, 1,5, 1,6, 1,7 and II: e,n,x, e,n,z<sub>15 </sub>respectively. Lanes 1 and 10: 100 bp MW standard; lane 2: multiplex PCR control for H2 antigen complexes I: 1,2; 1,5; 1,6; 1,7 and II: e,n,x; e,n,z<sub>15</sub>; lane 3: <it>S. enterica </it>serovar Typhimurium <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>; lane 4: <it>S. enterica </it>serovar Infantis <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B5">5</abbr></abbrgrp>; lane 5: <it>S. enterica </it>serovar Anatum <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B6">6</abbr></abbrgrp>; lane 6, <it>S. enterica </it>serovar Bredeney <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B7">7</abbr></abbrgrp>; lane 7: <it>S. enterica </it>serovar Hadar [e,n,x]; lane 8: <it>S. enterica </it>serovar Mbandaka [e,n,z<sub>15</sub>]; and lane 9: no DNA control. The sizes of the PCR amplicons are 294 bp for H2 antigen complex I: 1,2; 1,5; 1,6; 1,7 and 152 bp for H2 antigen complex II: e,n,x and e,n,z<sub>15</sub>.</p>
               </text>
               <graphic file="1471-2180-8-178-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Comparison of multiplex PCR allelotyping of O, H1, and H2 genes with conventional serotyping in differentiating <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg and Typhimurium</p>
            </st>
            <p>Validation of the allelotyping method is important for its integration with conventional <it>Salmonella </it>culture and typing methods used in diagnostic and food microbiology <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>. We therefore assessed the allelotyping multiplex PCR against the standard conventional <it>Salmonella </it>serotyping method in identifying <it>Salmonella </it>O, H1 and H2 antigens for 43 different serovars of salmonellae isolated mainly from chicken carcasses and poultry environments (Tables <tblr tid="T2">2</tblr> and <tblr tid="T3">3</tblr>).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Allelotyping PCR scheme for presumptive identification of <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>
                           <b>O-multiplex</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>H1-multiplexes</b>
                           <sup>1</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>H2-multiplex</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Serovars</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sensitivity</b>
                           <sup>5</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Specificity</b>
                           <sup>5</sup>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>i</p>
                     </c>
                     <c ca="center">
                        <p>I<sup>2</sup></p>
                     </c>
                     <c ca="left">
                        <p>Typhimurium</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="center">
                        <p>r</p>
                     </c>
                     <c ca="center">
                        <p>I</p>
                     </c>
                     <c ca="left">
                        <p>Heidelberg</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>C2</p>
                     </c>
                     <c ca="center">
                        <p>z<sub>10</sub></p>
                     </c>
                     <c ca="center">
                        <p>II<sup>3</sup></p>
                     </c>
                     <c ca="left">
                        <p>Hadar</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>A/D1</p>
                     </c>
                     <c ca="center">
                        <p>g,m</p>
                     </c>
                     <c ca="center">
                        <p>-<sup>4</sup></p>
                     </c>
                     <c ca="left">
                        <p>Enteritidis</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>0.96</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>1</sup>Identifies H1 alleles i; g,m; r; or z<sub>10</sub></p>
                  <p><sup>2 </sup>Covers H2 alleles 1,2; 1,5; 1,6; and 1,7</p>
                  <p><sup>3 </sup>Covers H2 alleles e,n,x and e,n,z<sub>15</sub></p>
                  <p><sup>4 </sup>PCR negative for H2-multiplex</p>
                  <p><sup>5</sup>Sensitivity and specificity of the allelotyping PCR scheme relative to conventional serotyping in identifying <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium among the 239 isolates examined in this study.</p>
               </tblfn>
            </tbl>
            <p>The allelotyping PCR scheme for identifying <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg and Typhimurium is envisioned to work as follows. An initial multiplex PCR is performed to determine which O antigen allele that an isolate possesses and a serogroup designation is given or unknown, based on PCR results. If the isolate possesses O alleles for serogroups B, C2, or A/D1, then a 2<sup>nd </sup>allelotyping PCR is done to determine the presence of H2 alleles: i; g,m; r; or z<sub>10</sub>. Based on the results of this 2<sup>nd </sup>allelotyping PCR, an H1 allele type can be given an isolate as either being i; g,m; r; z<sub>10 </sub>or unknown, if no amplicons with the expected size for the H1 allelotyping PCR are produced. If both O and H1 allelotyping PCR detects O and H1 alleles associated with <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium, then a 3<sup>rd </sup>final H2 allelotyping PCR is performed to further differentiate the isolate to serovar level. Therefore, identifying one allele for each O, H1, and H2 allelotyping PCR, as listed in Table <tblr tid="T3">3</tblr>; it is possible to discern the serovar for isolates typed using this PCR-based scheme. For example, identification of serogroup B, H1 i, and H2 I antigen complex by multiplex PCR presumptively identifies the isolate as <it>S. enterica </it>serovar Typhimurium (Sensitivity = 1.00; Specificity = 1.00) (Table <tblr tid="T3">3</tblr>). The expansion of O-antigen PCR to detect serogroups C1 and E1, affords a laboratory the opportunity to detect other <it>S. enterica </it>serovars, as the antigenic formula for O, H1 and H2 antigens defines the serovar. Therefore, we were able to identify additional <it>S. enterica </it>serovars with our multiplex PCRs including Haifa [B; z<sub>10</sub>; 1,2], Infantis [C1; r; 1,5], and Mbandaka [C1; z<sub>10</sub>, e,n,z<sub>15</sub>]. We can also identify monophasic <it>S. enterica </it>serovars (ex. Montevideo: [C1; g,m,s; -]) by including a generic <it>Salmonella fljB </it>(H2) PCR test <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Isolates negative for O, H1, and H2 alleles by our multiplex PCR screen would need to be characterized by traditional serotyping, RFLP PCR <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, or PCR screens that identify the other H1 and H2 alleles <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B22">22</abbr></abbrgrp>. The limitations with our multiplex PCR are that it cannot distinguish among serogroup/serovar variants that arise due to phage conversion and the resulting chemical/antigenic alteration of the somatic O antigen <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> (ex. Hadar vs. Istanbul), or subtle point mutations in H2 antigen gene, <it>fljB </it>responsible for loss of flagellar expression observed in some <it>S. enterica </it>serovar Typhimurium strains <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Our multiplex PCRs were designed to be used as a rapid screen for <it>S. enterica </it>serovars: Enteritidis, Hadar, Heidelberg, and Typhimurium, targeting key genes/alleles that differentiate these serovars from the rest. As a diagnostic test, our allelotyping PCR was also designed to minimize the cost of this test to a few individual PCR tests, with a minimum number of primers needed for this typing scheme. Unfortunately, our H2 multiplex PCR cannot discern differences within the H2 antigen complexes (Table <tblr tid="T2">2</tblr>) to make a definitive serovar designation for <it>S. enterica </it>serovars with the same O and H1 antigens as our target serovars (<it>S. enterica </it>serovars: Typhimurium [H2: 1,2] vs. Lagos [H2: 1,5]; Heidelberg [H2: 1,2] vs. Bradford [H2: 1,5], Winneba [H2: 1,6] or Remo [H2: 1,7]; or Hadar [H2: e,n,x] vs. Glostrup [H2: e,n,z15]). Also, the allelotyping primers for H1 g,m allele identifies those H1 alleles bearing g or m in any possible combination (Table <tblr tid="T2">2</tblr>), therefore H1 multiplex would not be able to discern serogroup D1, <it>S. enterica </it>serovars Enteritidis [H1: g,m] from Blegdam [g,m,q]. While the possibility of encountering these alternate serovars may be remote based on epidemiological data <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>, it is still a possibility, and where a reporting laboratory may require confirmatory testing there are additional PCR based tests that can discern these allelic differences to make a final, definitive serovar designation possible <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. Alternatively, the H2 amplicons can be sequenced to definitively identify the H2 allele. Although several multiplex PCRs have been developed to assist laboratories in identification of <it>S. enterica </it>serovars <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B22">22</abbr></abbrgrp>, our results are the first to focus on, validate and describe a PCR-based scheme for assisting diagnostic labs in differentiating <it>S. enterica </it>serovars: Enteritidis, Hadar, Heidelberg, and Typhimurium.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The conventional <it>Salmonella </it>serological serotyping scheme is a time-consuming, labor-intensive and expensive procedure. With this PCR based allelotyping scheme, specific <it>S. enterica </it>serovars can be differentiated rapidly. The method is cost-effective and needs little technical training. This multiplex PCR allows large service laboratories to rapidly identify <it>S. enterica </it>serovars of public health importance including Enteritidis, Hadar, Heidelberg, and Typhimurium and focus conventional efforts towards identification of unusual serovars.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Bacterial strains</p>
            </st>
            <p>The <it>S. enterica </it>isolates used in this study were from multiple animal species, including human, poultry, livestock and wildlife <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>, and serotyped by the National Veterinary Service Laboratory (NVSL; Ames, IA) using classical methods (Table <tblr tid="T2">2</tblr>). The isolates were used to test the specificity of PCRs specific for O, H1 and H2 alleles described in Table <tblr tid="T1">1</tblr>. Additional <it>Salmonella </it>isolates of unknown serovars were obtained from two poultry farms in northeast Georgia <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B31">31</abbr></abbrgrp> as well as salmonellae isolated from routine submissions to the Poultry Diagnostic and Research Center (PDRC) in Athens, GA.</p>
         </sec>
         <sec>
            <st>
               <p>Isolation and serotyping of <it>Salmonella</it></p>
            </st>
            <p>We sampled the commercial chicken broiler house environment and chicken carcasses for <it>Salmonella </it>as previously described <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. The processing, enrichment, isolation and final diagnostic confirmation of <it>Salmonella </it>from samples is described in detail elsewhere <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Serotyping was done using standard serological typing procedures for <it>Salmonella </it>O, H1 and H2 antigens <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>PCR primer design</p>
            </st>
            <p>From comparative analysis of the <it>wba </it>operon for <it>Salmonella </it>serogroups A/D1, B, C1, C2, and E1 <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp> we identified serogroup-specific gene(s) (National Center for Biotechnology Information (NCBI) Accession #: M29682, X56793, X61917, M84642, X60665) for PCR primer design. Similarly, we identified from an alignment within the central variable region <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp> of <it>fliC </it>(H1) and <it>fljB </it>(H2) alleles (NCBI accession #: D13689, M84974, AF15949, AF332601, U06199, U06206, U06225, U06197, M84973, Z15086, D78639, Z15071, Z15072, Z15069, U06205, U06204, AF420426, AF420425, AF045151, U17175, U17171, U17172, AF425736, AF425737), using the DNA analysis software AlignPlus<sup>&#174; </sup>version 3.0 (Scientific and Educational Software), candidate sequences to differentiate <it>Salmonella </it>with the H1 flagellin antigens i, g,m, r, z<sub>10</sub>, and the H2 flagellin antigen complexes 1,2, 1,5, 1,6, 1,7 and e,n,x, e,n,z<sub>15 </sub>alleles. We analyzed these gene sequences, using the GeneRunner<sup>&#174; </sup>(Hastings software; Hastings, NY) DNA analysis software, and identified suitable primer sets that were compatible in a single multiplex PCR reaction and designed to produce an amplicon with size unique for the sequence(s) targeted by a specific primer set (Table <tblr tid="T1">1</tblr>).</p>
         </sec>
         <sec>
            <st>
               <p>Multiplex allelotyping PCR for Salmonella O, H1, and H2 antigen genes and differentiating <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium</p>
            </st>
            <p>The O-antigen multiplex PCR was designed to detect serogroup A/D1, B, C1, C2, or E1 specific genes or alleles (Table <tblr tid="T1">1</tblr>). The O-antigen multiplex PCR was performed using the Amplitron II Thermolyne thermocycler (Barnstead; Dubuque, IA), using HotStart PCR tubes (Molecular Bio-Products, Inc., San Diego, CA). Each reaction had a final concentration of 1.5 mM MgCl<sub>2</sub>, 50 mM Tris, pH 8.3, 0.25 mg/ml bovine serum albumin, 0.5 &#956;M primer, 0.2 mM deoxynucleotides (Boehringer Mannheim; Indianapolis, IN), 0.5 units of <it>Taq </it>DNA polymerase (Boehringer Mannheim), and 1 &#956;l of whole cell template. The PCR was performed with pre-amplification heating as described by D'Aquilla et al. <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. The program parameters for PCR include an initial five minutes incubation at 85&#176;C, to mix the two PCR reaction mixes, followed by 30 cycles of denaturation (94&#176;C for 1 min), annealing (55&#176;C for 1 min), and extension (72&#176;C for 1 min). Amplicons were separated on 1.5% agarose gel with Tris-acetate-EDTA buffer <abbrgrp><abbr bid="B41">41</abbr></abbrgrp> and ethidium bromide (0.2 &#956;g/ml) at 100 V. The 100-bp ladder (GIBCO/BRL, Gaithersburg, MD) was used as a molecular weight (MW) standard for determining the MW of the PCR products. Various <it>S. enterica </it>serovars belonging to serogroups A/D1, B, C1, C2, E1 were used in the PCR to test the specificity of the primer sets.</p>
            <p>The H1-1 multiplex PCR was used to identify isolates with antigens i or g, m; while the H1-2 multiplex PCR was designed to detect isolates with antigens r or z<sub>10</sub>. Finally, the H2 multiplex PCR was created to differentiate isolates with either H2 antigen complexes 1,2; 1,5; 1,6; 1,7; or e,n,x; e,n,z<sub>15</sub>. In order to identify the H1 and H2 alleles, capillary PCR reaction was performed to amplify the alleles of <it>fliC </it>and <it>fljB </it>by three multiplex PCRs with the Rapidycler&#8482; hot-air thermocycler (Idaho Technologies; Idaho Falls, ID) <abbrgrp><abbr bid="B42">42</abbr></abbrgrp> in 10-&#956;l capacity capillary tubes. We sought to reduce the expense of reagents and reaction time by utilizing a capillary thermocycler that accommodates very low reaction volumes. The 10-&#956;l PCR mix for the <it>fliC </it>i and g,m multiplex consisted of 2.0 mM MgCl<sub>2</sub>, 50 mM Tris (pH 8.3), 0.25 mg/ml bovine serum albumin, 0.5 &#956;M of each primer, 0.2 mM deoxynucleotides, 5% DMSO, 1.0 units of <it>Taq </it>DNA polymerase, and 1 &#956;l whole cell template. For <it>fliC </it>r and z<sub>10 </sub>multiplex, 3.0 mM MgCl<sub>2 </sub>and 1.0 &#956;M of each primer were used for each reaction. For the amplification of the H2 alleles, the <it>fljB </it>multiplex consisted of 3.75 mM MgCl<sub>2</sub>, 62.5 mM Tris, pH 8.3, 0.31 mg/ml bovine serum albumin, 0.5 &#956;M of each primer, 0.2 mM deoxynucleotides, 5% DMSO, 1.0 units of <it>Taq </it>DNA polymerase, and 1 &#956;l whole cell template in a 10 &#956;l volume. The program parameters for the hot-air thermocycler were an initial heating step of 94&#176;C for 1 min; 94&#176;C for 1 sec, 55&#176;C for 1 sec, and 72&#176;C for 20 sec with a slope of 2.0 for 40 cycles; and a final extension at 72&#176;C for 4 min. Amplicons were detected as described above. The specificity of the PCR detection was tested against various <it>Salmonella </it>serovars possessing the relevant <it>fliC </it>and <it>fljB </it>alleles (Table <tblr tid="T2">2</tblr>). <it>Escherichia coli </it>LE392 served as a negative control. Whole cell template for all multiplex PCRs was prepared according to the procedures of Hilton et al. <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Statistics</p>
            </st>
            <p>Kappa statistics were calculated to evaluate the agreement between the classical serotyping systems and multiplex PCR for each of the antigen groups examined. Sensitivity and specificity of the allelotyping PCR scheme relative to conventional serotyping was calculated for <it>S. enterica </it>serovars Enteritidis, Hadar, Heidelberg, and Typhimurium.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>CDC: Center for Disease Control and Prevention; FSIS: Food Safety Inspection Service; HACCP: Hazard Analysis and Critical Control Point; NCBI: National Center for Biotechnology Information; NPIP: National Poultry Improvement Plant; PCR: polymerase chain reaction; PFGE: pulsed-field gel electrophoresis; RFLP: restriction fragment polymorphism; SNP: single nucleotide polymorphism; USDA: United States Department of Agriculture.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>JJM designed, directed, and supervised most aspects of this project. YH designed, and optimized the multiplex PCRs described in this study, as well as wrote the first draft of this manuscript. MDL and CH were involved in translation of these molecular tests to the diagnostic lab. CH was instrumental in our access to poultry farms and companies to obtain samples/isolates for testing. TL assessed the multiplex PCR in identifying <it>S. enterica </it>serovars for isolates submitted to the PDRC diagnostic lab. MDL and DW were involved in instruction, supervision, and interpretation of classical serotyping. MM and SA assisted in conventional serotyping of isolates. LW did statistical analyses of PCR vs. classical serotyping. RB evaluated and interpreted the statistical tests. MM, TL, and SA roles in this study were beyond those normally associated with their jobs and the University of Georgia or FDA. All authors have read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>USDA NRICGP grant 99-35212-8680, USDA Formula Funds, and the State of Georgia's Veterinary Medicine Agricultural Research Grant supported this work. We thank Dr. Douglas Waltman for his helpful comments and advice.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food-10 states, 2006</p>
            </title>
            <aug>
               <au>
                  <snm>Vugia</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cronquist</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hadler</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tobin-D'Angelo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Blythe</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lathrop</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Morse</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cieslak</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Holt</snm>
                  <fnm>KG</fnm>
               </au>
               <au>
                  <snm>Gruzewich</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Scallan</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Angulo</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Griffin</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Tauxe</snm>
                  <fnm>RV</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>SK</fnm>
               </au>
            </aug>
            <source>Morbid Mortal Weekly Rep</source>
            <pubdate>2007</pubdate>
            <volume>56</volume>
            <fpage>336</fpage>
            <lpage>339</lpage>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Estimating the incidence of food-borne <it>Salmonella </it>and the effectiveness of alternative control measures using the Delphi method</p>
            </title>
            <aug>
               <au>
                  <snm>Henson</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Int J Food Microbiol</source>
            <pubdate>1997</pubdate>
            <volume>35</volume>
            <fpage>195</fpage>
            <lpage>204</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9105928</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Surveillance for foodborne-disease outbreaks-United States, 1998&#8211;2002</p>
            </title>
            <aug>
               <au>
                  <snm>Lynch</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Painter</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Woodruff</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Braden</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Morbid Mortal Weekly Rep</source>
            <pubdate>2006</pubdate>
            <issue>Suppl 10</issue>
            <fpage>1</fpage>
            <lpage>34</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pubmed">17093388</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>National Poultry Improvement Plan and Auxiliary Provisions</p>
            </title>
            <aug>
               <au>
                  <cnm>Anonymous</cnm>
               </au>
            </aug>
            <source>Code of Federal Regulations</source>
            <pubdate>2007</pubdate>
            <volume>9</volume>
            <fpage>1</fpage>
            <lpage>153</lpage>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Animal sources of salmonellosis in humans</p>
            </title>
            <aug>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hofacre</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Doyle</snm>
                  <fnm>MP</fnm>
               </au>
            </aug>
            <source>J Am Vet Med Assoc</source>
            <pubdate>2002</pubdate>
            <volume>221</volume>
            <fpage>492</fpage>
            <lpage>497</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12184697</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>PulseNet USA: a five-year update</p>
            </title>
            <aug>
               <au>
                  <snm>Gerner-Smidt</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hise</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kincaid</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hunter</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rolando</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hyytia-Trees</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ribot</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Swaminathan</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>PulseNet</snm>
                  <fnm>Taskforce</fnm>
               </au>
            </aug>
            <source>Foodborne Pathog Dis</source>
            <pubdate>2006</pubdate>
            <volume>3</volume>
            <fpage>9</fpage>
            <lpage>19</lpage>
            <xrefbib>
               <pubid idtype="pmpid">16602975</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Fluorescent amplified-fragment length polymorphism genotyping of <it>Salmonella enterica </it>subsp. <it>enterica </it>serovars and comparison with pulsed-field gel electrophoresis typing</p>
            </title>
            <aug>
               <au>
                  <snm>Lindstedt</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Heir</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Vardund</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kapperud</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>38</volume>
            <fpage>1623</fpage>
            <lpage>1627</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">86504</pubid>
                  <pubid idtype="pmpid" link="fulltext">10747153</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p><it>Salmonella </it>Surveillance Annual Summary</p>
            </title>
            <pubdate>2005</pubdate>
            <url>http://www.cdc.gov/ncidod/dbmd/phlisdata/salmtab/2005/SalmonellaAnnualSummary2005.pdf</url>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Serotype Profile of <it>Salmonella </it>from Meat and Poultry</p>
            </title>
            <url>http://www/fsis.usda.gov/PDF/Serotypes_Profile_Salmonella_Tables_&amp;_Figures.pdf</url>
         </bibl>
         <bibl id="B10">
            <title>
               <p>WHO Global <it>Salmonella </it>Survey, Progress Report</p>
            </title>
            <url>http://www.who.int/salmsurv/links/GSSProgressReport2005.pdf</url>
         </bibl>
         <bibl id="B11">
            <title>
               <p>The covalent structure of the phase-1 flagellar filament protein of <it>Salmonella typhimurium </it>and its comparison with other flagellins</p>
            </title>
            <aug>
               <au>
                  <snm>Joys</snm>
                  <fnm>TM</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1985</pubdate>
            <volume>260</volume>
            <fpage>15758</fpage>
            <lpage>15761</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">2999134</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Biosynthesis of O-antigens: genes and pathways involved in nucleotide sugar precursor synthesis and O-antigen assembly</p>
            </title>
            <aug>
               <au>
                  <snm>Samuel</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Carbohydr Res</source>
            <pubdate>2003</pubdate>
            <volume>338</volume>
            <fpage>2503</fpage>
            <lpage>2519</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">14670712</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Relationships among the O-antigen gene clusters of <it>Salmonella enterica </it>groups B, D1, D2, and D3</p>
            </title>
            <aug>
               <au>
                  <snm>Curd</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1998</pubdate>
            <volume>180</volume>
            <fpage>1002</fpage>
            <lpage>1007</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">106985</pubid>
                  <pubid idtype="pmpid" link="fulltext">9473060</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Restriction fragment length polymorphism analysis of some flagellin genes of <it>Salmonella enterica</it></p>
            </title>
            <aug>
               <au>
                  <snm>Dauga</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Zabrovskaia</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Grimont</snm>
                  <fnm>PAD</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>36</volume>
            <fpage>2835</fpage>
            <lpage>2843</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">105073</pubid>
                  <pubid idtype="pmpid" link="fulltext">9738029</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Multiplex PCR-based detection and identification of the most common <it>Salmonella </it>second-phase flagellar antigens</p>
            </title>
            <aug>
               <au>
                  <snm>Echeita</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Herrera</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Garaiznar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Usera</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Res Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>153</volume>
            <fpage>107</fpage>
            <lpage>113</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11900263</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Rapid identification of <it>Salmonella </it>spp. phase 2 antigens of the H2 antigenic complex using "multiplex PCR"</p>
            </title>
            <aug>
               <au>
                  <snm>Echeita</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Usera</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Res Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>149</volume>
            <fpage>757</fpage>
            <lpage>761</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9921582</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Selective amplification of abequose and paratose synthase genes (<it>rfb</it>) by polymerase chain reaction for identification of <it>Salmonella </it>major serogroups (A, B, C2, and D)</p>
            </title>
            <aug>
               <au>
                  <snm>Luk</snm>
                  <fnm>JMC</fnm>
               </au>
               <au>
                  <snm>Kongmuang</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Lindberg</snm>
                  <fnm>AA</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1993</pubdate>
            <volume>31</volume>
            <fpage>2118</fpage>
            <lpage>2123</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">265708</pubid>
                  <pubid idtype="pmpid" link="fulltext">8370740</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Development of primers to O-antigen biosynthesis genes for specific detection of <it>Escherichia coli </it>O157 by PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Petrosko</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bolton</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>MD</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>1999</pubdate>
            <volume>65</volume>
            <fpage>2954</fpage>
            <lpage>2960</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">91442</pubid>
                  <pubid idtype="pmpid" link="fulltext">10388689</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Making PCR a normal routine of the food microbiology lab</p>
            </title>
            <aug>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>PCR Methods in Foods</source>
            <pubdate>2006</pubdate>
            <fpage>51</fpage>
            <lpage>68</lpage>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Identification and sequence of <it>rfbS </it>and <it>rfbE</it>, which determine antigenic specificity of group A and group D salmonellae</p>
            </title>
            <aug>
               <au>
                  <snm>Verma</snm>
                  <fnm>NK</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1989</pubdate>
            <volume>171</volume>
            <fpage>5694</fpage>
            <lpage>5701</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">210416</pubid>
                  <pubid idtype="pmpid" link="fulltext">2793833</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Evolutionary origin and radiation of the avian-adapted non-motile salmonellae</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Crichton</snm>
                  <fnm>PB</fnm>
               </au>
               <au>
                  <snm>Old</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Whittam</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Selander</snm>
                  <fnm>RK</fnm>
               </au>
            </aug>
            <source>J Med Microbiol</source>
            <pubdate>1993</pubdate>
            <volume>38</volume>
            <fpage>129</fpage>
            <lpage>139</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8429538</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Blind comparison of traditional serotyping with three multiplex PCRs for the identification of <it>Salmonella </it>serotypes</p>
            </title>
            <aug>
               <au>
                  <snm>Herrera-Leon</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ramiro</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Arroyo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Diez</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Usera</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Echeita</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Res Microbiol</source>
            <pubdate>2007</pubdate>
            <volume>158</volume>
            <fpage>122</fpage>
            <lpage>127</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17258433</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Comparison of cultivation and PCR-hybridization for detection of <it>Salmonella </it>in porcine fecal and water samples</p>
            </title>
            <aug>
               <au>
                  <snm>Feder</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Nietfeld</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Galland</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yearly</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sargeant</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Oberst</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Tamplin</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Luchansky</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2001</pubdate>
            <volume>39</volume>
            <fpage>2477</fpage>
            <lpage>2484</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">88173</pubid>
                  <pubid idtype="pmpid" link="fulltext">11427557</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Rapid detection of <it>Campylobacter coli</it>, <it>C. jejuni </it>and <it>Salmonella enterica </it>on poultry carcasses using PCR-enzyme-linked immunosorbent assay</p>
            </title>
            <aug>
               <au>
                  <snm>Hong</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Berrang</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hofacre</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>69</volume>
            <fpage>3492</fpage>
            <lpage>3499</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">161512</pubid>
                  <pubid idtype="pmpid" link="fulltext">12788755</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Application of nested polymerase chain reaction to detection of <it>Salmonella </it>in poultry environment</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Liljebjelke</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bartlett</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Hofacre</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>J Food Prot</source>
            <pubdate>2002</pubdate>
            <volume>65</volume>
            <fpage>1227</fpage>
            <lpage>1232</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12182472</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Molecular characterization reveals <it>Salmonella enterica </it>serovar 4,[5],12:i:- from poultry is a variant Typhimurium serovar</p>
            </title>
            <aug>
               <au>
                  <snm>Zamperini</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Soni</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Waltman</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Theriault</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Bray</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Avian Dis</source>
            <pubdate>2007</pubdate>
            <volume>51</volume>
            <fpage>958</fpage>
            <lpage>964</lpage>
            <xrefbib>
               <pubid idtype="pmpid">18251408</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Reference collection of strains of the <it>Salmonella typhimurium </it>complex from natural populations</p>
            </title>
            <aug>
               <au>
                  <snm>Beltran</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Plock</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Whittam</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Old</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Selander</snm>
                  <fnm>RK</fnm>
               </au>
            </aug>
            <source>J Gen Microbiol</source>
            <pubdate>1991</pubdate>
            <volume>137</volume>
            <fpage>601</fpage>
            <lpage>606</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2033380</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p><it>Salmonella </it>reference collection B (SARB): strains of 37 serovars of subspecies I</p>
            </title>
            <aug>
               <au>
                  <snm>Boyd</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Beltran</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Plock</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Selander</snm>
                  <fnm>RK</fnm>
               </au>
            </aug>
            <source>J Gen Microbiol</source>
            <pubdate>1993</pubdate>
            <volume>139</volume>
            <fpage>1125</fpage>
            <lpage>1132</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8360609</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Genetic relatedness of <it>Salmonella </it>isolates from nondomestic birds in Southeastern United States</p>
            </title>
            <aug>
               <au>
                  <snm>Hudson</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Quist</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Keyes</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Dodson</snm>
                  <fnm>SV</fnm>
               </au>
               <au>
                  <snm>Morales</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>38</volume>
            <fpage>1860</fpage>
            <lpage>1865</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">86608</pubid>
                  <pubid idtype="pmpid" link="fulltext">10790113</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Virulence determinants <it>invA </it>and <it>spvC </it>in salmonellae isolated from poultry products, wastewater, and human sources</p>
            </title>
            <aug>
               <au>
                  <snm>Swamy</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Barnhart</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Dreesen</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>1996</pubdate>
            <volume>62</volume>
            <fpage>3768</fpage>
            <lpage>3771</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">168184</pubid>
                  <pubid idtype="pmpid" link="fulltext">8837432</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Vertical and horizontal transmission of <it>Salmonella </it>within integrated broiler production system</p>
            </title>
            <aug>
               <au>
                  <snm>Liljebjelke</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Hofacre</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Ayers</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Maurer</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Foodborne Path Dis</source>
            <pubdate>2005</pubdate>
            <volume>2</volume>
            <fpage>90</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15992303</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <aug>
               <au>
                  <cnm>Anonymous</cnm>
               </au>
            </aug>
            <source>Difco Manual</source>
            <publisher>Sparks: Difco Laboratories, Division of Becton Dickinson and Co</publisher>
            <edition>11</edition>
            <pubdate>1998</pubdate>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Molecular analysis of the <it>rfb </it>gene cluster of <it>Salmonella </it>serovar Muenchen (strain M67): the genetic basis of the polymorphism between groups C2 and B</p>
            </title>
            <aug>
               <au>
                  <snm>Brown</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Romana</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1992</pubdate>
            <volume>6</volume>
            <fpage>1385</fpage>
            <lpage>1394</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1379320</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Structure and sequence of the <it>rfb </it>(O-antigen) gene cluster of <it>Salmonella </it>serovar typhimurium (Strain LT2)</p>
            </title>
            <aug>
               <au>
                  <snm>Jiang</snm>
                  <fnm>XM</fnm>
               </au>
               <au>
                  <snm>Neal</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Santiago</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Romana</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1991</pubdate>
            <volume>5</volume>
            <fpage>695</fpage>
            <lpage>713</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1710759</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Sequence and structural analysis of the <it>rfb </it>(O antigen) gene cluster from a group C1 <it>Salmonella enterica </it>strain</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Romana</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>J Gen Microbiol</source>
            <pubdate>1992</pubdate>
            <volume>138</volume>
            <fpage>1843</fpage>
            <lpage>1855</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1383393</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Relationship among the <it>rfb </it>regions of <it>Salmonella </it>serovars A, B, and D</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Verma</snm>
                  <fnm>NK</fnm>
               </au>
               <au>
                  <snm>Romana</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1991</pubdate>
            <volume>173</volume>
            <fpage>4814</fpage>
            <lpage>4819</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">208160</pubid>
                  <pubid idtype="pmpid" link="fulltext">1856174</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Molecular analysis of a <it>Salmonella enterica </it>group E1 <it>rfb </it>gene cluster: O antigen and the genetic basis of the major polymorphism</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Romana</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>PR</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1992</pubdate>
            <volume>130</volume>
            <fpage>432</fpage>
            <lpage>443</lpage>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Molecular analyses of the <it>Salmonella </it>g flagellar antigen complex</p>
            </title>
            <aug>
               <au>
                  <snm>Masten</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Joys</snm>
                  <fnm>TM</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1993</pubdate>
            <volume>175</volume>
            <fpage>5359</fpage>
            <lpage>5365</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">206590</pubid>
                  <pubid idtype="pmpid" link="fulltext">7690024</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Molecular analyses of the phase-2 antigen complex 1, 2 of <it>Salmonella </it>spp</p>
            </title>
            <aug>
               <au>
                  <snm>Vanegas</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Joys</snm>
                  <fnm>TM</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1995</pubdate>
            <volume>177</volume>
            <fpage>3863</fpage>
            <lpage>3864</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">177107</pubid>
                  <pubid idtype="pmpid" link="fulltext">7541401</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Maximizing sensitivity and specificity of PCR by pre-amplification heating</p>
            </title>
            <aug>
               <au>
                  <snm>D'Aquilla</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Bechtel</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Videler</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Eron</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Gorczyca</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kaplan</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Nucl Acids Res</source>
            <pubdate>1991</pubdate>
            <volume>19</volume>
            <fpage>3749</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">328414</pubid>
                  <pubid idtype="pmpid" link="fulltext">1852616</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Molecular Cloning: a Laboratory Manual</p>
            </title>
            <aug>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Maniatis</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <cnm>Eds</cnm>
               </au>
            </aug>
            <publisher>Cold Spring Harbor: Cold Spring Harbor Laboratory Press</publisher>
            <edition>2</edition>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Automated polymerase chain reaction capillary tubes with hot air</p>
            </title>
            <aug>
               <au>
                  <snm>Wittwer</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Fillmore</snm>
                  <fnm>GC</fnm>
               </au>
               <au>
                  <snm>Hillyard</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Nucl Acids Res</source>
            <pubdate>1989</pubdate>
            <volume>17</volume>
            <fpage>4353</fpage>
            <lpage>4357</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">317939</pubid>
                  <pubid idtype="pmpid" link="fulltext">2740218</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Optimization of RAPD for fingerprinting <it>Salmonella</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hilton</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Banks</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Penn</snm>
                  <fnm>CW</fnm>
               </au>
            </aug>
            <source>Lett Appl Microbiol</source>
            <pubdate>1997</pubdate>
            <volume>24</volume>
            <fpage>243</fpage>
            <lpage>248</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9134770</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
